EMAIL THIS PAGE TO A FRIEND

PCDHGA2

protocadherin gamma subfamily A, 2

123 Gene Product Result for
Synonyms: PCDH-GAMMA-A2
UniProtKB ID: Q9Y5H1, Q52LL6, Q9Y5D5
Gene ID:
Human(56113) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93710) protocadherin gamma subfamily A, 2
Rat(498846) protocadherin gamma subfamily A, 2
naked mole-rat(101707494) protocadherin gamma subfamily A, 2
cow(539654) protocadherin gamma subfamily A, 2
sheep(101104993) protocadherin gamma subfamily A, 2
chicken(431363) protocadherin gamma subfamily A, 2
domestic cat(101097204) protocadherin gamma subfamily A, 2
dog(607521) protocadherin gamma subfamily A, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018915 Rosetta Predictions human pricing
NM_032009 Rosetta Predictions human pricing
NM_001037139 Rosetta Predictions rat pricing
NM_033585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352354 predicted 1126
2 SASI_Hs01_00052388 predicted 1805
3 SASI_Hs02_00352355 predicted 1621
4 SASI_Hs01_00052389 predicted 275
5 SASI_Hs01_00052390 predicted 1032
6 SASI_Hs01_00052391 predicted 626
7 SASI_Hs01_00052392 predicted 1373
8 SASI_Hs01_00052393 predicted 681
9 SASI_Hs01_00052394 predicted 695
10 SASI_Hs01_00052396 predicted 1722
11 SASI_Hs01_00052395 predicted 514
12 SASI_Hs01_00052397 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359181 predicted 1126
2 SASI_Hs01_00169723 predicted 1802
3 SASI_Hs02_00359182 predicted 1628
4 SASI_Hs01_00169724 predicted 271
5 SASI_Hs01_00169725 predicted 1038
6 SASI_Hs01_00169726 predicted 622
7 SASI_Hs01_00169727 predicted 1380
8 SASI_Hs01_00169728 predicted 685
9 SASI_Hs01_00169729 predicted 691
10 SASI_Hs01_00169731 predicted 1719
11 SASI_Hs01_00169730 predicted 518
12 SASI_Hs01_00169732 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088508 predicted 2829
2 SASI_Rn01_00088511 predicted 361
3 SASI_Rn01_00088512 predicted 896
4 SASI_Rn01_00088513 predicted 1081
5 SASI_Rn01_00088515 predicted 2321
6 SASI_Rn01_00088516 predicted 1361
7 SASI_Rn01_00088517 predicted 1410
8 SASI_Rn02_00204233 predicted 1040
9 SASI_Rn02_00204234 predicted 920
10 SASI_Rn02_00204235 predicted 610
11 SASI_Rn01_00088509 predicted 1408
12 SASI_Rn01_00088510 predicted 1951
13 SASI_Rn01_00088514 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170093 predicted 358
2 SASI_Mm01_00170094 predicted 2654
3 SASI_Mm01_00170095 predicted 1243
4 SASI_Mm01_00170096 predicted 1156
5 SASI_Mm01_00170097 predicted 614
6 SASI_Mm01_00170098 predicted 1192
7 SASI_Mm01_00170099 predicted 2209
8 SASI_Mm01_00170100 predicted 892
9 SASI_Mm02_00337439 predicted 861
10 SASI_Mm01_00170101 predicted 433
11 SASI_Mm01_00170102 predicted 28
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018915
PCDHGA2 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018915.2-3885s1c1
Sequence:CCGGCCAGCCATAAACCAATAACTACTCGAGTAGTTATTGGTTTATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-2565s1c1
Sequence:CCGGCCTCAATCTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAGATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1048s1c1
Sequence:CCGGCCTCAGAGGTATTTGAGCTTACTCGAGTAAGCTCAAATACCTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1627s1c1
Sequence:CCGGGCAACGACAATGCTCATGTAACTCGAGTTACATGAGCATTGTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-512s1c1
Sequence:CCGGGCTGGAGGATAAATTGACTATCTCGAGATAGTCAATTTATCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018915
PCDHGA2 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018915.2-3885s1c1
Sequence:CCGGCCAGCCATAAACCAATAACTACTCGAGTAGTTATTGGTTTATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-2565s1c1
Sequence:CCGGCCTCAATCTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAGATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1048s1c1
Sequence:CCGGCCTCAGAGGTATTTGAGCTTACTCGAGTAAGCTCAAATACCTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1627s1c1
Sequence:CCGGGCAACGACAATGCTCATGTAACTCGAGTTACATGAGCATTGTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-512s1c1
Sequence:CCGGGCTGGAGGATAAATTGACTATCTCGAGATAGTCAATTTATCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018915
PCDHGA2 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018915.2-3885s1c1
Sequence:CCGGCCAGCCATAAACCAATAACTACTCGAGTAGTTATTGGTTTATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-2565s1c1
Sequence:CCGGCCTCAATCTCTACTCGAAGAACTCGAGTTCTTCGAGTAGAGATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1048s1c1
Sequence:CCGGCCTCAGAGGTATTTGAGCTTACTCGAGTAAGCTCAAATACCTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-1627s1c1
Sequence:CCGGGCAACGACAATGCTCATGTAACTCGAGTTACATGAGCATTGTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018915.2-512s1c1
Sequence:CCGGGCTGGAGGATAAATTGACTATCTCGAGATAGTCAATTTATCCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033585
PCDHGA2 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-442s1c1
Sequence:CCGGCCAGGATTCAGGATTCCTCTTCTCGAGAAGAGGAATCCTGAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033585.1-3825s1c1
Sequence:CCGGCGACGACTTCTAAGTGAGTTTCTCGAGAAACTCACTTAGAAGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-1463s1c1
Sequence:CCGGCCTACTCTTTAGCTGAAGATACTCGAGTATCTTCAGCTAAAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-2380s1c1
Sequence:CCGGCCTCAGTCTTTACTTGATGATCTCGAGATCATCAAGTAAAGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-917s1c1
Sequence:CCGGGTCTGGATTATGAGAAAGCTACTCGAGTAGCTTTCTCATAATCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033585
PCDHGA2 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-442s1c1
Sequence:CCGGCCAGGATTCAGGATTCCTCTTCTCGAGAAGAGGAATCCTGAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033585.1-3825s1c1
Sequence:CCGGCGACGACTTCTAAGTGAGTTTCTCGAGAAACTCACTTAGAAGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-1463s1c1
Sequence:CCGGCCTACTCTTTAGCTGAAGATACTCGAGTATCTTCAGCTAAAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-2380s1c1
Sequence:CCGGCCTCAGTCTTTACTTGATGATCTCGAGATCATCAAGTAAAGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-917s1c1
Sequence:CCGGGTCTGGATTATGAGAAAGCTACTCGAGTAGCTTTCTCATAATCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033585
PCDHGA2 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-442s1c1
Sequence:CCGGCCAGGATTCAGGATTCCTCTTCTCGAGAAGAGGAATCCTGAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033585.1-3825s1c1
Sequence:CCGGCGACGACTTCTAAGTGAGTTTCTCGAGAAACTCACTTAGAAGTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-1463s1c1
Sequence:CCGGCCTACTCTTTAGCTGAAGATACTCGAGTATCTTCAGCTAAAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-2380s1c1
Sequence:CCGGCCTCAGTCTTTACTTGATGATCTCGAGATCATCAAGTAAAGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033585.1-917s1c1
Sequence:CCGGGTCTGGATTATGAGAAAGCTACTCGAGTAGCTTTCTCATAATCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)