EMAIL THIS PAGE TO A FRIEND

PCDHGA3

protocadherin gamma subfamily A, 3

171 Gene Product Result for
Synonyms: PCDH-GAMMA-A3
UniProtKB ID: Q9Y5H0, Q9Y5D4
Gene ID:
Human(56112) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93711) protocadherin gamma subfamily A, 3
Rat(498847) protocadherin gamma subfamily A, 3
Horse(100146335) protocadherin gamma subfamily A, 3
dog(607531) protocadherin gamma subfamily A, 3
domestic cat(101099929) protocadherin gamma subfamily A, 3
cow(511275) protocadherin gamma subfamily A, 3
sheep(101102564) protocadherin gamma subfamily A, 3
naked mole-rat(101707124) protocadherin gamma subfamily A, 3
domestic guinea pig(100718892) protocadherin gamma subfamily A, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302398 ANTI-PCDHGA3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA039295 Anti-PCDHGA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB5201293 Monoclonal Anti-Protocadherin - Alkaline Phosphatase antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201294 Monoclonal Anti-Protocadherin - Apc antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201285 Monoclonal Anti-Protocadherin - Atto 390 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201286 Monoclonal Anti-Protocadherin - Atto 488 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201287 Monoclonal Anti-Protocadherin - Atto 565 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201288 Monoclonal Anti-Protocadherin - Atto 594 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201289 Monoclonal Anti-Protocadherin - Atto 633 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201290 Monoclonal Anti-Protocadherin - Atto 655 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201291 Monoclonal Anti-Protocadherin - Atto 680 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201292 Monoclonal Anti-Protocadherin - Atto 700 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201295 Monoclonal Anti-Protocadherin - Biotin antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201296 Monoclonal Anti-Protocadherin - Fitc antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201297 Monoclonal Anti-Protocadherin - Hrp antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201298 Monoclonal Anti-Protocadherin - Pe/Atto 594 antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201299 Monoclonal Anti-Protocadherin - Percp antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201300 Monoclonal Anti-Protocadherin - Rpe antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201301 Monoclonal Anti-Protocadherin - Streptavidin antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201284 Monoclonal Anti-Protocadherin antibody produced in mouse clone S144-17, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201329 Monoclonal Anti-Protocadherin Gamma A (Pan) - Alkaline Phosphatase antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201330 Monoclonal Anti-Protocadherin Gamma A (Pan) - Apc antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201321 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 390 antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201322 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 488 antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201323 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 565 antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201324 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 594 antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201325 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 633 antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201326 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 655 antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201327 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 680 antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201328 Monoclonal Anti-Protocadherin Gamma A (Pan) - Atto 700 antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201331 Monoclonal Anti-Protocadherin Gamma A (Pan) - Biotin antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201332 Monoclonal Anti-Protocadherin Gamma A (Pan) - Fitc antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201333 Monoclonal Anti-Protocadherin Gamma A (Pan) - Hrp antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201334 Monoclonal Anti-Protocadherin Gamma A (Pan) - Pe/Atto 594 antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201335 Monoclonal Anti-Protocadherin Gamma A (Pan) - Percp antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201336 Monoclonal Anti-Protocadherin Gamma A (Pan) - Rpe antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201337 Monoclonal Anti-Protocadherin Gamma A (Pan) - Streptavidin antibody produced in mouse clone S144-32, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201320 Monoclonal Anti-Protocadherin Gamma A (Pan) antibody produced in mouse clone S144-32, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018916 Rosetta Predictions human pricing
NM_032011 Rosetta Predictions human pricing
NM_001037154 Rosetta Predictions rat pricing
XM_574131 Rosetta Predictions rat pricing
NM_033586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207773 predicted 930
2 SASI_Hs01_00207774 predicted 1578
3 SASI_Hs01_00207775 predicted 730
4 SASI_Hs01_00207776 predicted 1563
5 SASI_Hs01_00207777 predicted 808
6 SASI_Hs01_00207779 predicted 1300
7 SASI_Hs01_00207780 predicted 1153
8 SASI_Hs01_00207781 predicted 682
9 SASI_Hs01_00207782 predicted 533
10 SASI_Hs02_00352356 predicted 1294
11 SASI_Hs01_00207778 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139553 predicted 932
2 SASI_Hs01_00139554 predicted 1575
3 SASI_Hs01_00139555 predicted 724
4 SASI_Hs01_00139556 predicted 1565
5 SASI_Hs01_00139557 predicted 806
6 SASI_Hs01_00139559 predicted 1302
7 SASI_Hs01_00139560 predicted 1157
8 SASI_Hs01_00139561 predicted 682
9 SASI_Hs01_00139562 predicted 539
10 SASI_Hs02_00359183 predicted 1294
11 SASI_Hs01_00139558 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047887 predicted 2825
2 SASI_Rn01_00047889 predicted 1401
3 SASI_Rn01_00047890 predicted 1525
4 SASI_Rn01_00047891 predicted 1602
5 SASI_Rn01_00047892 predicted 2372
6 SASI_Rn01_00047893 predicted 1742
7 SASI_Rn02_00204238 predicted 694
8 SASI_Rn01_00047895 predicted 1621
9 SASI_Rn02_00204239 predicted 1256
10 SASI_Rn02_00204240 predicted 2408
11 SASI_Rn01_00047888 predicted 472
12 SASI_Rn01_00047894 predicted 896
13 SASI_Rn01_00047896 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172306 predicted 682
2 SASI_Rn01_00172307 predicted 302
3 SASI_Rn01_00172308 predicted 1240
4 SASI_Rn01_00172309 predicted 1354
5 SASI_Rn01_00172310 predicted 1434
6 SASI_Rn01_00172311 predicted 1577
7 SASI_Rn01_00172312 predicted 724
8 SASI_Rn01_00172313 predicted 538
9 SASI_Rn01_00172314 predicted 1455
10 SASI_Rn01_00172315 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129391 predicted 2807
2 SASI_Mm02_00337440 predicted 2855
3 SASI_Mm01_00129387 predicted 1719
4 SASI_Mm01_00129388 predicted 878
5 SASI_Mm01_00129389 predicted 1796
6 SASI_Mm01_00129390 predicted 1357
7 SASI_Mm01_00129392 predicted 1700
8 SASI_Mm01_00129393 predicted 2353
9 SASI_Mm01_00129394 predicted 664
10 SASI_Mm01_00129395 predicted 1593
11 SASI_Mm01_00129396 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033586
PCDHGA3 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033586.2-4460s1c1
Sequence:CCGGCGTCTGTCCTTTGAATCTCAACTCGAGTTGAGATTCAAAGGACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-885s1c1
Sequence:CCGGCCAGAGTACCATGTCAGTGTTCTCGAGAACACTGACATGGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1143s1c1
Sequence:CCGGGCCAAGGTTCTTGTAACGGTTCTCGAGAACCGTTACAAGAACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1514s1c1
Sequence:CCGGCGCCTCCTATTCAGCCTATATCTCGAGATATAGGCTGAATAGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-2517s1c1
Sequence:CCGGCCTCTTATAATACCTCAAGATCTCGAGATCTTGAGGTATTATAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-973s21c1
Sequence:CCGGATGCTCAAGTGTCCTATATTCCTCGAGGAATATAGGACACTTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1786s21c1
Sequence:CCGGACACAACACTGAACCTATTTGCTCGAGCAAATAGGTTCAGTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-840s21c1
Sequence:CCGGGTGATAGTCTCGGATGCAAATCTCGAGATTTGCATCCGAGACTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-597s21c1
Sequence:CCGGGGAACCCGATTCCCACTTAAACTCGAGTTTAAGTGGGAATCGGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-512s21c1
Sequence:CCGGAGTTGACATTAGCGATATTAACTCGAGTTAATATCGCTAATGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-666s21c1
Sequence:CCGGCTCAATTCCAATGACTATTTCCTCGAGGAAATAGTCATTGGAATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1388s21c1
Sequence:CCGGTGAGGAGGTGTCCCAATATAACTCGAGTTATATTGGGACACCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033586
PCDHGA3 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033586.2-4460s1c1
Sequence:CCGGCGTCTGTCCTTTGAATCTCAACTCGAGTTGAGATTCAAAGGACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-885s1c1
Sequence:CCGGCCAGAGTACCATGTCAGTGTTCTCGAGAACACTGACATGGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1143s1c1
Sequence:CCGGGCCAAGGTTCTTGTAACGGTTCTCGAGAACCGTTACAAGAACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1514s1c1
Sequence:CCGGCGCCTCCTATTCAGCCTATATCTCGAGATATAGGCTGAATAGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-2517s1c1
Sequence:CCGGCCTCTTATAATACCTCAAGATCTCGAGATCTTGAGGTATTATAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-973s21c1
Sequence:CCGGATGCTCAAGTGTCCTATATTCCTCGAGGAATATAGGACACTTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1786s21c1
Sequence:CCGGACACAACACTGAACCTATTTGCTCGAGCAAATAGGTTCAGTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-840s21c1
Sequence:CCGGGTGATAGTCTCGGATGCAAATCTCGAGATTTGCATCCGAGACTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-597s21c1
Sequence:CCGGGGAACCCGATTCCCACTTAAACTCGAGTTTAAGTGGGAATCGGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-512s21c1
Sequence:CCGGAGTTGACATTAGCGATATTAACTCGAGTTAATATCGCTAATGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-666s21c1
Sequence:CCGGCTCAATTCCAATGACTATTTCCTCGAGGAAATAGTCATTGGAATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1388s21c1
Sequence:CCGGTGAGGAGGTGTCCCAATATAACTCGAGTTATATTGGGACACCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033586
PCDHGA3 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033586.2-4460s1c1
Sequence:CCGGCGTCTGTCCTTTGAATCTCAACTCGAGTTGAGATTCAAAGGACAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-885s1c1
Sequence:CCGGCCAGAGTACCATGTCAGTGTTCTCGAGAACACTGACATGGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1143s1c1
Sequence:CCGGGCCAAGGTTCTTGTAACGGTTCTCGAGAACCGTTACAAGAACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-1514s1c1
Sequence:CCGGCGCCTCCTATTCAGCCTATATCTCGAGATATAGGCTGAATAGGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033586.2-2517s1c1
Sequence:CCGGCCTCTTATAATACCTCAAGATCTCGAGATCTTGAGGTATTATAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-973s21c1
Sequence:CCGGATGCTCAAGTGTCCTATATTCCTCGAGGAATATAGGACACTTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1786s21c1
Sequence:CCGGACACAACACTGAACCTATTTGCTCGAGCAAATAGGTTCAGTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-840s21c1
Sequence:CCGGGTGATAGTCTCGGATGCAAATCTCGAGATTTGCATCCGAGACTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-597s21c1
Sequence:CCGGGGAACCCGATTCCCACTTAAACTCGAGTTTAAGTGGGAATCGGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-512s21c1
Sequence:CCGGAGTTGACATTAGCGATATTAACTCGAGTTAATATCGCTAATGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-666s21c1
Sequence:CCGGCTCAATTCCAATGACTATTTCCTCGAGGAAATAGTCATTGGAATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033586.2-1388s21c1
Sequence:CCGGTGAGGAGGTGTCCCAATATAACTCGAGTTATATTGGGACACCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018916
PCDHGA3 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1233s1c1
Sequence:CCGGCCGCGAACAAATATCAGAATACTCGAGTATTCTGATATTTGTTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1158s1c1
Sequence:CCGGCCTGGGAAATCTGCCATTTAACTCGAGTTAAATGGCAGATTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-991s1c1
Sequence:CCGGGCCAAGATTCTAGTCACGGTTCTCGAGAACCGTGACTAGAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1566s1c1
Sequence:CCGGCGAGCAATTTAGAGACTTAAACTCGAGTTTAAGTCTCTAAATTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-497s1c1
Sequence:CCGGCCCTGCAGAACTACAAGCTTACTCGAGTAAGCTTGTAGTTCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-821s21c1
Sequence:CCGGATGCTCAAGTGTCTTATATTCCTCGAGGAATATAAGACACTTGAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-1193s21c1
Sequence:CCGGTAGATCAATATTACCGCTTAGCTCGAGCTAAGCGGTAATATTGATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-889s21c1
Sequence:CCGGGTGAGTGGAGAAGTATCAATACTCGAGTATTGATACTTCTCCACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-445s21c1
Sequence:CCGGGGAACCCGATTTCCAATTAAACTCGAGTTTAATTGGAAATCGGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018916
PCDHGA3 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1233s1c1
Sequence:CCGGCCGCGAACAAATATCAGAATACTCGAGTATTCTGATATTTGTTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1158s1c1
Sequence:CCGGCCTGGGAAATCTGCCATTTAACTCGAGTTAAATGGCAGATTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-991s1c1
Sequence:CCGGGCCAAGATTCTAGTCACGGTTCTCGAGAACCGTGACTAGAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1566s1c1
Sequence:CCGGCGAGCAATTTAGAGACTTAAACTCGAGTTTAAGTCTCTAAATTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-497s1c1
Sequence:CCGGCCCTGCAGAACTACAAGCTTACTCGAGTAAGCTTGTAGTTCTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-821s21c1
Sequence:CCGGATGCTCAAGTGTCTTATATTCCTCGAGGAATATAAGACACTTGAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-1193s21c1
Sequence:CCGGTAGATCAATATTACCGCTTAGCTCGAGCTAAGCGGTAATATTGATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-889s21c1
Sequence:CCGGGTGAGTGGAGAAGTATCAATACTCGAGTATTGATACTTCTCCACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-445s21c1
Sequence:CCGGGGAACCCGATTTCCAATTAAACTCGAGTTTAATTGGAAATCGGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018916
PCDHGA3 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1233s1c1
Sequence:CCGGCCGCGAACAAATATCAGAATACTCGAGTATTCTGATATTTGTTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1158s1c1
Sequence:CCGGCCTGGGAAATCTGCCATTTAACTCGAGTTAAATGGCAGATTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-991s1c1
Sequence:CCGGGCCAAGATTCTAGTCACGGTTCTCGAGAACCGTGACTAGAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-1566s1c1
Sequence:CCGGCGAGCAATTTAGAGACTTAAACTCGAGTTTAAGTCTCTAAATTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018916.3-497s1c1
Sequence:CCGGCCCTGCAGAACTACAAGCTTACTCGAGTAAGCTTGTAGTTCTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-821s21c1
Sequence:CCGGATGCTCAAGTGTCTTATATTCCTCGAGGAATATAAGACACTTGAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-1193s21c1
Sequence:CCGGTAGATCAATATTACCGCTTAGCTCGAGCTAAGCGGTAATATTGATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-889s21c1
Sequence:CCGGGTGAGTGGAGAAGTATCAATACTCGAGTATTGATACTTCTCCACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018916.3-445s21c1
Sequence:CCGGGGAACCCGATTTCCAATTAAACTCGAGTTTAATTGGAAATCGGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)