EMAIL THIS PAGE TO A FRIEND

PCDHGA5

protocadherin gamma subfamily A, 5

135 Gene Product Result for
Synonyms: CDH-GAMMA-A5 ME3 PCDH-GAMMA-A5
UniProtKB ID: Q9Y5G8, Q2M3F5, Q9Y5D2
Gene ID:
Human(56110) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93713) protocadherin gamma subfamily A, 5
Rat(291637) protocadherin gamma subfamily A, 5
Horse(100061508) protocadherin gamma subfamily A, 5
dog(487181) protocadherin gamma subfamily A, 5
domestic cat(101098190) protocadherin gamma subfamily A, 5
cow(539653) protocadherin gamma subfamily A, 5
sheep(101105244) protocadherin gamma subfamily A, 5
naked mole-rat(101699484) protocadherin gamma subfamily A, 5
Domestic Rabbit(100353908) protocadherin gamma subfamily A, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018918 Rosetta Predictions human pricing
NM_032054 Rosetta Predictions human pricing
NM_001037137 Rosetta Predictions rat pricing
NM_033588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100281 predicted 817
2 SASI_Hs01_00100282 predicted 865
3 SASI_Hs02_00352358 predicted 934
4 SASI_Hs02_00352359 predicted 357
5 SASI_Hs01_00100284 predicted 973
6 SASI_Hs01_00100285 predicted 1103
7 SASI_Hs01_00100286 predicted 1555
8 SASI_Hs01_00100287 predicted 1004
9 SASI_Hs02_00352360 predicted 1004
10 SASI_Hs01_00100288 predicted 353
11 SASI_Hs01_00100283 predicted 1313
12 SASI_Hs01_00100289 predicted 1849
13 SASI_Hs01_00100290 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055102 predicted 817
2 SASI_Hs01_00055103 predicted 863
3 SASI_Hs02_00359255 predicted 926
4 SASI_Hs02_00359256 predicted 358
5 SASI_Hs01_00055105 predicted 969
6 SASI_Hs01_00055106 predicted 1105
7 SASI_Hs01_00055107 predicted 1559
8 SASI_Hs01_00055108 predicted 997
9 SASI_Hs02_00359257 predicted 1002
10 SASI_Hs01_00055109 predicted 349
11 SASI_Hs01_00055104 predicted 1322
12 SASI_Hs01_00055110 predicted 1848
13 SASI_Hs01_00055111 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076619 predicted 2825
2 SASI_Rn01_00076620 predicted 1026
3 SASI_Rn01_00076621 predicted 245
4 SASI_Rn01_00076622 predicted 1624
5 SASI_Rn01_00076623 predicted 1066
6 SASI_Rn01_00076625 predicted 689
7 SASI_Rn02_00204231 predicted 517
8 SASI_Rn01_00076627 predicted 887
9 SASI_Rn01_00076628 predicted 2222
10 SASI_Rn02_00204232 predicted 1408
11 SASI_Rn01_00076624 predicted 2177
12 SASI_Rn01_00076626 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198145 predicted 2661
2 SASI_Mm02_00337442 predicted 2706
3 SASI_Mm01_00198144 predicted 1625
4 SASI_Mm01_00198146 predicted 1538
5 SASI_Mm01_00198148 predicted 2259
6 SASI_Mm01_00198149 predicted 864
7 SASI_Mm01_00198150 predicted 731
8 SASI_Mm02_00337443 predicted 1993
9 SASI_Mm01_00198152 predicted 2051
10 SASI_Mm02_00337444 predicted 2005
11 SASI_Mm01_00198147 predicted 1350
12 SASI_Mm01_00198151 predicted 1227
13 SASI_Mm01_00198153 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033588
PCDHGA5 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033588.2-3896s1c1
Sequence:CCGGCAATGGATTTAAGCTGACATTCTCGAGAATGTCAGCTTAAATCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-922s1c1
Sequence:CCGGCGCAAAGTTGACCTTCTCTTTCTCGAGAAAGAGAAGGTCAACTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2104s1c1
Sequence:CCGGCCCAGATGTACTGACTGACTTCTCGAGAAGTCAGTCAGTACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2105s1c1
Sequence:CCGGCCAGATGTACTGACTGACTTACTCGAGTAAGTCAGTCAGTACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-792s1c1
Sequence:CCGGCCGTTCTTGATGCAAACGATACTCGAGTATCGTTTGCATCAAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033588
PCDHGA5 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033588.2-3896s1c1
Sequence:CCGGCAATGGATTTAAGCTGACATTCTCGAGAATGTCAGCTTAAATCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-922s1c1
Sequence:CCGGCGCAAAGTTGACCTTCTCTTTCTCGAGAAAGAGAAGGTCAACTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2104s1c1
Sequence:CCGGCCCAGATGTACTGACTGACTTCTCGAGAAGTCAGTCAGTACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2105s1c1
Sequence:CCGGCCAGATGTACTGACTGACTTACTCGAGTAAGTCAGTCAGTACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-792s1c1
Sequence:CCGGCCGTTCTTGATGCAAACGATACTCGAGTATCGTTTGCATCAAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033588
PCDHGA5 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033588.2-3896s1c1
Sequence:CCGGCAATGGATTTAAGCTGACATTCTCGAGAATGTCAGCTTAAATCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-922s1c1
Sequence:CCGGCGCAAAGTTGACCTTCTCTTTCTCGAGAAAGAGAAGGTCAACTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2104s1c1
Sequence:CCGGCCCAGATGTACTGACTGACTTCTCGAGAAGTCAGTCAGTACATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-2105s1c1
Sequence:CCGGCCAGATGTACTGACTGACTTACTCGAGTAAGTCAGTCAGTACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033588.2-792s1c1
Sequence:CCGGCCGTTCTTGATGCAAACGATACTCGAGTATCGTTTGCATCAAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018918
PCDHGA5 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1316s1c1
Sequence:CCGGCCTTGAAAGTAGCAGACGTTACTCGAGTAACGTCTGCTACTTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-2367s1c1
Sequence:CCGGGCCTCTTCTGATGTCTGATAACTCGAGTTATCAGACATCAGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-298s1c1
Sequence:CCGGCCACTGTGTGTGGTGAACTTTCTCGAGAAAGTTCACCACACACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-866s1c1
Sequence:CCGGCGGAGACTTTCCAACTTGATTCTCGAGAATCAAGTTGGAAAGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1099s1c1
Sequence:CCGGGCGCTGTTTAGCGTACATGATCTCGAGATCATGTACGCTAAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-695s21c1
Sequence:CCGGTCCTCGACGCAAACGACAATGCTCGAGCATTGTCGTTTGCGTCGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1182s21c1
Sequence:CCGGGGAGAAGTCAGTTGATAATTACTCGAGTAATTATCAACTGACTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-810s21c1
Sequence:CCGGTGAGGGAATAAACGGGAAATTCTCGAGAATTTCCCGTTTATTCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1138s21c1
Sequence:CCGGGGTGAGATTGCATGCTCTATTCTCGAGAATAGAGCATGCAATCTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018918
PCDHGA5 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1316s1c1
Sequence:CCGGCCTTGAAAGTAGCAGACGTTACTCGAGTAACGTCTGCTACTTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-2367s1c1
Sequence:CCGGGCCTCTTCTGATGTCTGATAACTCGAGTTATCAGACATCAGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-298s1c1
Sequence:CCGGCCACTGTGTGTGGTGAACTTTCTCGAGAAAGTTCACCACACACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-866s1c1
Sequence:CCGGCGGAGACTTTCCAACTTGATTCTCGAGAATCAAGTTGGAAAGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1099s1c1
Sequence:CCGGGCGCTGTTTAGCGTACATGATCTCGAGATCATGTACGCTAAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-695s21c1
Sequence:CCGGTCCTCGACGCAAACGACAATGCTCGAGCATTGTCGTTTGCGTCGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1182s21c1
Sequence:CCGGGGAGAAGTCAGTTGATAATTACTCGAGTAATTATCAACTGACTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-810s21c1
Sequence:CCGGTGAGGGAATAAACGGGAAATTCTCGAGAATTTCCCGTTTATTCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1138s21c1
Sequence:CCGGGGTGAGATTGCATGCTCTATTCTCGAGAATAGAGCATGCAATCTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018918
PCDHGA5 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1316s1c1
Sequence:CCGGCCTTGAAAGTAGCAGACGTTACTCGAGTAACGTCTGCTACTTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-2367s1c1
Sequence:CCGGGCCTCTTCTGATGTCTGATAACTCGAGTTATCAGACATCAGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-298s1c1
Sequence:CCGGCCACTGTGTGTGGTGAACTTTCTCGAGAAAGTTCACCACACACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-866s1c1
Sequence:CCGGCGGAGACTTTCCAACTTGATTCTCGAGAATCAAGTTGGAAAGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018918.2-1099s1c1
Sequence:CCGGGCGCTGTTTAGCGTACATGATCTCGAGATCATGTACGCTAAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-695s21c1
Sequence:CCGGTCCTCGACGCAAACGACAATGCTCGAGCATTGTCGTTTGCGTCGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1182s21c1
Sequence:CCGGGGAGAAGTCAGTTGATAATTACTCGAGTAATTATCAACTGACTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-810s21c1
Sequence:CCGGTGAGGGAATAAACGGGAAATTCTCGAGAATTTCCCGTTTATTCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018918.2-1138s21c1
Sequence:CCGGGGTGAGATTGCATGCTCTATTCTCGAGAATAGAGCATGCAATCTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)