EMAIL THIS PAGE TO A FRIEND

PCDHGA6

protocadherin gamma subfamily A, 6

120 Gene Product Result for
Synonyms: PCDH-GAMMA-A6
UniProtKB ID: Q9Y5G7, A6H8K7, B2RN55, Q9Y5D1
Gene ID:
Human(56109) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93714) protocadherin gamma subfamily A, 6
Rat(502156) protocadherin gamma subfamily A, 6
domestic guinea pig(100720555) protocadherin gamma subfamily A, 6
Domestic Rabbit(100352484) protocadherin gamma subfamily A, 6
cow(100337150) protocadherin gamma subfamily A, 6
domestic cat(101098682) protocadherin gamma subfamily A, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018919 Rosetta Predictions human pricing
NM_032086 Rosetta Predictions human pricing
XM_577612 Rosetta Predictions rat pricing
NM_033589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145139 predicted 700
2 SASI_Hs01_00145140 predicted 986
3 SASI_Hs01_00145141 predicted 502
4 SASI_Hs01_00145142 predicted 1615
5 SASI_Hs01_00145143 predicted 732
6 SASI_Hs01_00145144 predicted 920
7 SASI_Hs01_00145145 predicted 672
8 SASI_Hs02_00352361 predicted 1217
9 SASI_Hs01_00145146 predicted 608
10 SASI_Hs01_00145148 predicted 1360
11 SASI_Hs01_00145147 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132749 predicted 702
2 SASI_Hs01_00132750 predicted 983
3 SASI_Hs01_00132751 predicted 503
4 SASI_Hs01_00132752 predicted 1616
5 SASI_Hs01_00132753 predicted 725
6 SASI_Hs01_00132754 predicted 915
7 SASI_Hs01_00132755 predicted 676
8 SASI_Hs02_00359258 predicted 1225
9 SASI_Hs01_00132756 predicted 610
10 SASI_Hs01_00132758 predicted 1359
11 SASI_Hs01_00132757 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406829 predicted 1537
2 SASI_Rn02_00406830 predicted 1349
3 SASI_Rn02_00406831 predicted 928
4 SASI_Rn02_00406832 predicted 2280
5 SASI_Rn02_00406833 predicted 893
6 SASI_Rn02_00406834 predicted 1095
7 SASI_Rn02_00406835 predicted 954
8 SASI_Rn02_00406836 predicted 1184
9 SASI_Rn02_00406837 predicted 1361
10 SASI_Rn02_00406838 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132334 predicted 2661
2 SASI_Mm02_00337445 predicted 2703
3 SASI_Mm01_00132331 predicted 2313
4 SASI_Mm01_00132332 predicted 2197
5 SASI_Mm01_00132333 predicted 1110
6 SASI_Mm01_00132335 predicted 1035
7 SASI_Mm02_00337446 predicted 1244
8 SASI_Mm01_00132337 predicted 2050
9 SASI_Mm01_00132338 predicted 1138
10 SASI_Mm01_00132339 predicted 782
11 SASI_Mm01_00132336 predicted 897
12 SASI_Mm01_00132340 predicted 1787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018919
PCDHGA6 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-349s21c1
Sequence:CCGGTATCCCGTGGAAGTGGAAATACTCGAGTATTTCCACTTCCACGGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-991s21c1
Sequence:CCGGGCGAAAGTCTTAATAACTATCCTCGAGGATAGTTATTAAGACTTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-1192s21c1
Sequence:CCGGGTTGGCAATTATTATCGATTACTCGAGTAATCGATAATAATTGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-392s1c1
Sequence:CCGGCCCGATTCTTAAAGGAAGAATCTCGAGATTCTTCCTTTAAGAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-676s1c1
Sequence:CCGGGCCCAAATTCTGGTAACAGTTCTCGAGAACTGTTACCAGAATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-513s1c1
Sequence:CCGGGCTCAGTGGTAATAGTCACTTCTCGAGAAGTGACTATTACCACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-1159s1c1
Sequence:CCGGCCGAGAAGTCTCCCATTTGAACTCGAGTTCAAATGGGAGACTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-2288s1c1
Sequence:CCGGCGCGTAAGAGTCATCTGATTTCTCGAGAAATCAGATGACTCTTACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018919
PCDHGA6 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-349s21c1
Sequence:CCGGTATCCCGTGGAAGTGGAAATACTCGAGTATTTCCACTTCCACGGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-991s21c1
Sequence:CCGGGCGAAAGTCTTAATAACTATCCTCGAGGATAGTTATTAAGACTTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-1192s21c1
Sequence:CCGGGTTGGCAATTATTATCGATTACTCGAGTAATCGATAATAATTGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-392s1c1
Sequence:CCGGCCCGATTCTTAAAGGAAGAATCTCGAGATTCTTCCTTTAAGAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-676s1c1
Sequence:CCGGGCCCAAATTCTGGTAACAGTTCTCGAGAACTGTTACCAGAATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-513s1c1
Sequence:CCGGGCTCAGTGGTAATAGTCACTTCTCGAGAAGTGACTATTACCACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-1159s1c1
Sequence:CCGGCCGAGAAGTCTCCCATTTGAACTCGAGTTCAAATGGGAGACTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-2288s1c1
Sequence:CCGGCGCGTAAGAGTCATCTGATTTCTCGAGAAATCAGATGACTCTTACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018919
PCDHGA6 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-349s21c1
Sequence:CCGGTATCCCGTGGAAGTGGAAATACTCGAGTATTTCCACTTCCACGGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-991s21c1
Sequence:CCGGGCGAAAGTCTTAATAACTATCCTCGAGGATAGTTATTAAGACTTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018919.2-1192s21c1
Sequence:CCGGGTTGGCAATTATTATCGATTACTCGAGTAATCGATAATAATTGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-392s1c1
Sequence:CCGGCCCGATTCTTAAAGGAAGAATCTCGAGATTCTTCCTTTAAGAATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-676s1c1
Sequence:CCGGGCCCAAATTCTGGTAACAGTTCTCGAGAACTGTTACCAGAATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-513s1c1
Sequence:CCGGGCTCAGTGGTAATAGTCACTTCTCGAGAAGTGACTATTACCACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-1159s1c1
Sequence:CCGGCCGAGAAGTCTCCCATTTGAACTCGAGTTCAAATGGGAGACTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018919.2-2288s1c1
Sequence:CCGGCGCGTAAGAGTCATCTGATTTCTCGAGAAATCAGATGACTCTTACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033589
PCDHGA6 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily A, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033589.1-3655s1c1
Sequence:CCGGGCCTGTTAATAGGGTCTTGCACTCGAGTGCAAGACCCTATTAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1139s1c1
Sequence:CCGGGCCTGGTAATATGCTCCATATCTCGAGATATGGAGCATATTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1235s1c1
Sequence:CCGGGCGAACAGGTATCTTCGTATACTCGAGTATACGAAGATACCTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1359s1c1
Sequence:CCGGCCGTTCATCCTACTCTGTCTACTCGAGTAGACAGAGTAGGATGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-2157s1c1
Sequence:CCGGGCACAAGTCAAGATTGCTGAACTCGAGTTCAGCAATCTTGACTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033589
PCDHGA6 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily A, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033589.1-3655s1c1
Sequence:CCGGGCCTGTTAATAGGGTCTTGCACTCGAGTGCAAGACCCTATTAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1139s1c1
Sequence:CCGGGCCTGGTAATATGCTCCATATCTCGAGATATGGAGCATATTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1235s1c1
Sequence:CCGGGCGAACAGGTATCTTCGTATACTCGAGTATACGAAGATACCTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1359s1c1
Sequence:CCGGCCGTTCATCCTACTCTGTCTACTCGAGTAGACAGAGTAGGATGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-2157s1c1
Sequence:CCGGGCACAAGTCAAGATTGCTGAACTCGAGTTCAGCAATCTTGACTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033589
PCDHGA6 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily A, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033589.1-3655s1c1
Sequence:CCGGGCCTGTTAATAGGGTCTTGCACTCGAGTGCAAGACCCTATTAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1139s1c1
Sequence:CCGGGCCTGGTAATATGCTCCATATCTCGAGATATGGAGCATATTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1235s1c1
Sequence:CCGGGCGAACAGGTATCTTCGTATACTCGAGTATACGAAGATACCTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-1359s1c1
Sequence:CCGGCCGTTCATCCTACTCTGTCTACTCGAGTAGACAGAGTAGGATGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033589.1-2157s1c1
Sequence:CCGGGCACAAGTCAAGATTGCTGAACTCGAGTTCAGCAATCTTGACTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)