EMAIL THIS PAGE TO A FRIEND

PCDHGB1

protocadherin gamma subfamily B, 1

115 Gene Product Result for
Synonyms: PCDH-GAMMA-B1
UniProtKB ID: Q9Y5G3, Q3SY75, Q9Y5C8
Gene ID:
Human(56104) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93699) protocadherin gamma subfamily B, 1
domestic guinea pig(100720280) protocadherin gamma subfamily B, 1
naked mole-rat(101699132) protocadherin gamma subfamily B, 1
cow(100848177) protocadherin gamma subfamily B, 1
sheep(101102813) protocadherin gamma subfamily B, 1
dog(607540) protocadherin gamma subfamily B, 1
domestic cat(101097450) protocadherin gamma subfamily B, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018922 Rosetta Predictions human pricing
NM_032095 Rosetta Predictions human pricing
NM_033574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352369 predicted 230
2 SASI_Hs01_00042193 predicted 1965
3 SASI_Hs01_00042194 predicted 666
4 SASI_Hs01_00042196 predicted 883
5 SASI_Hs01_00042197 predicted 703
6 SASI_Hs01_00042198 predicted 909
7 SASI_Hs01_00042199 predicted 920
8 SASI_Hs01_00042200 predicted 578
9 SASI_Hs01_00042201 predicted 514
10 SASI_Hs02_00352370 predicted 608
11 SASI_Hs01_00042192 predicted 1099
12 SASI_Hs01_00042195 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359276 predicted 229
2 SASI_Hs01_00046886 predicted 1961
3 SASI_Hs01_00046887 predicted 662
4 SASI_Hs01_00046889 predicted 885
5 SASI_Hs01_00046890 predicted 704
6 SASI_Hs01_00046891 predicted 911
7 SASI_Hs01_00046892 predicted 918
8 SASI_Hs01_00046893 predicted 579
9 SASI_Hs01_00046894 predicted 516
10 SASI_Hs02_00359277 predicted 606
11 SASI_Hs01_00046885 predicted 1101
12 SASI_Hs01_00046888 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137234 predicted 2620
2 SASI_Mm02_00337408 predicted 2666
3 SASI_Mm01_00137235 predicted 815
4 SASI_Mm02_00337409 predicted 729
5 SASI_Mm01_00137237 predicted 138
6 SASI_Mm01_00137238 predicted 859
7 SASI_Mm01_00137239 predicted 695
8 SASI_Mm01_00137241 predicted 1460
9 SASI_Mm01_00137242 predicted 2238
10 SASI_Mm02_00337410 predicted 2309
11 SASI_Mm01_00137236 predicted 540
12 SASI_Mm01_00137240 predicted 867
13 SASI_Mm01_00137243 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018922
PCDHGB1 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2290s21c1
Sequence:CCGGCTCAACCTGACACCGGAAATGCTCGAGCATTTCCGGTGTCAGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-194s21c1
Sequence:CCGGGGGTTAGTGCAGAGGATTATTCTCGAGAATAATCCTCTGCACTAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2232s21c1
Sequence:CCGGGCCCTATTCCTACAATCTATGCTCGAGCATAGATTGTAGGAATAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-603s21c1
Sequence:CCGGTCAGAGCTCTCATCGCTTAATCTCGAGATTAAGCGATGAGAGCTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-843s1c1
Sequence:CCGGCCCAATAAGTACCAGCCTCTTCTCGAGAAGAGGCTGGTACTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-252s1c1
Sequence:CCGGCGGTAGGATAGATCGAGAGAACTCGAGTTCTCTCGATCTATCCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-2359s1c1
Sequence:CCGGGCCAGTAATGAAGATCACAAACTCGAGTTTGTGATCTTCATTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-1046s1c1
Sequence:CCGGCTAACCAGATTCCAGAGGATTCTCGAGAATCCTCTGGAATCTGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-536s1c1
Sequence:CCGGCGAAGGAAAGTCCTGATGGAACTCGAGTTCCATCAGGACTTTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018922
PCDHGB1 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2290s21c1
Sequence:CCGGCTCAACCTGACACCGGAAATGCTCGAGCATTTCCGGTGTCAGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-194s21c1
Sequence:CCGGGGGTTAGTGCAGAGGATTATTCTCGAGAATAATCCTCTGCACTAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2232s21c1
Sequence:CCGGGCCCTATTCCTACAATCTATGCTCGAGCATAGATTGTAGGAATAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-603s21c1
Sequence:CCGGTCAGAGCTCTCATCGCTTAATCTCGAGATTAAGCGATGAGAGCTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-843s1c1
Sequence:CCGGCCCAATAAGTACCAGCCTCTTCTCGAGAAGAGGCTGGTACTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-252s1c1
Sequence:CCGGCGGTAGGATAGATCGAGAGAACTCGAGTTCTCTCGATCTATCCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-2359s1c1
Sequence:CCGGGCCAGTAATGAAGATCACAAACTCGAGTTTGTGATCTTCATTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-1046s1c1
Sequence:CCGGCTAACCAGATTCCAGAGGATTCTCGAGAATCCTCTGGAATCTGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-536s1c1
Sequence:CCGGCGAAGGAAAGTCCTGATGGAACTCGAGTTCCATCAGGACTTTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018922
PCDHGB1 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2290s21c1
Sequence:CCGGCTCAACCTGACACCGGAAATGCTCGAGCATTTCCGGTGTCAGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-194s21c1
Sequence:CCGGGGGTTAGTGCAGAGGATTATTCTCGAGAATAATCCTCTGCACTAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-2232s21c1
Sequence:CCGGGCCCTATTCCTACAATCTATGCTCGAGCATAGATTGTAGGAATAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018922.2-603s21c1
Sequence:CCGGTCAGAGCTCTCATCGCTTAATCTCGAGATTAAGCGATGAGAGCTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-843s1c1
Sequence:CCGGCCCAATAAGTACCAGCCTCTTCTCGAGAAGAGGCTGGTACTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-252s1c1
Sequence:CCGGCGGTAGGATAGATCGAGAGAACTCGAGTTCTCTCGATCTATCCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-2359s1c1
Sequence:CCGGGCCAGTAATGAAGATCACAAACTCGAGTTTGTGATCTTCATTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-1046s1c1
Sequence:CCGGCTAACCAGATTCCAGAGGATTCTCGAGAATCCTCTGGAATCTGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018922.2-536s1c1
Sequence:CCGGCGAAGGAAAGTCCTGATGGAACTCGAGTTCCATCAGGACTTTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033574
PCDHGB1 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033574.2-4315s1c1
Sequence:CCGGCCTAGCCCTTACAGTAGTGTACTCGAGTACACTACTGTAAGGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1232s1c1
Sequence:CCGGCCTCATTAAAGTTCGAGACAACTCGAGTTGTCTCGAACTTTAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-342s1c1
Sequence:CCGGGCAGAGGATTATTTCAGCGTTCTCGAGAACGCTGAAATAATCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1036s1c1
Sequence:CCGGCAACTAATGGTACATTGGATTCTCGAGAATCCAATGTACCATTAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-495s1c1
Sequence:CCGGGCCATCCAAGACATTAACGATCTCGAGATCGTTAATGTCTTGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033574
PCDHGB1 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033574.2-4315s1c1
Sequence:CCGGCCTAGCCCTTACAGTAGTGTACTCGAGTACACTACTGTAAGGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1232s1c1
Sequence:CCGGCCTCATTAAAGTTCGAGACAACTCGAGTTGTCTCGAACTTTAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-342s1c1
Sequence:CCGGGCAGAGGATTATTTCAGCGTTCTCGAGAACGCTGAAATAATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1036s1c1
Sequence:CCGGCAACTAATGGTACATTGGATTCTCGAGAATCCAATGTACCATTAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-495s1c1
Sequence:CCGGGCCATCCAAGACATTAACGATCTCGAGATCGTTAATGTCTTGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033574
PCDHGB1 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033574.2-4315s1c1
Sequence:CCGGCCTAGCCCTTACAGTAGTGTACTCGAGTACACTACTGTAAGGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1232s1c1
Sequence:CCGGCCTCATTAAAGTTCGAGACAACTCGAGTTGTCTCGAACTTTAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-342s1c1
Sequence:CCGGGCAGAGGATTATTTCAGCGTTCTCGAGAACGCTGAAATAATCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-1036s1c1
Sequence:CCGGCAACTAATGGTACATTGGATTCTCGAGAATCCAATGTACCATTAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033574.2-495s1c1
Sequence:CCGGGCCATCCAAGACATTAACGATCTCGAGATCGTTAATGTCTTGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)