EMAIL THIS PAGE TO A FRIEND

PCDHGB3

protocadherin gamma subfamily B, 3

98 Gene Product Result for
Synonyms: PCDH-GAMMA-B3
UniProtKB ID: Q9Y5G1, A7E229, Q9Y5C7
Gene ID:
Human(56102) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100352238) protocadherin gamma subfamily B, 3
cow(100337133) protocadherin gamma subfamily B, 3
sheep(101103066) protocadherin gamma subfamily B, 3
domestic cat(101098430) protocadherin gamma subfamily B, 3
dog(607565) protocadherin gamma subfamily B, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018924 Rosetta Predictions human pricing
NM_032097 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225514 predicted 2068
2 SASI_Hs01_00225515 predicted 1447
3 SASI_Hs01_00225516 predicted 828
4 SASI_Hs01_00225517 predicted 731
5 SASI_Hs01_00225518 predicted 866
6 SASI_Hs01_00225519 predicted 1123
7 SASI_Hs01_00225520 predicted 816
8 SASI_Hs02_00352373 predicted 279
9 SASI_Hs01_00225521 predicted 1998
10 SASI_Hs01_00225522 predicted 896
11 SASI_Hs01_00225523 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143535 predicted 2067
2 SASI_Hs01_00143536 predicted 1438
3 SASI_Hs01_00143537 predicted 821
4 SASI_Hs01_00143538 predicted 728
5 SASI_Hs01_00143539 predicted 864
6 SASI_Hs01_00143540 predicted 1129
7 SASI_Hs01_00143541 predicted 820
8 SASI_Hs02_00359280 predicted 276
9 SASI_Hs01_00143542 predicted 2006
10 SASI_Hs01_00143543 predicted 896
11 SASI_Hs01_00143544 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018924
PCDHGB3 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-768s21c1
Sequence:CCGGCGCTGGCTCCTCCGTATTAAACTCGAGTTTAATACGGAGGAGCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-2388s1c1
Sequence:CCGGGCCTTCTAATTCAGGCAATTTCTCGAGAAATTGCCTGAATTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-302s1c1
Sequence:CCGGCGTGTGTTCTGGAATTTGAAACTCGAGTTTCAAATTCCAGAACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-198s1c1
Sequence:CCGGGCGGGTTATTGCAGAGAAGAACTCGAGTTCTTCTCTGCAATAACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-1245s1c1
Sequence:CCGGCCCAGAATACAATGTGACGATCTCGAGATCGTCACATTGTATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-717s1c1
Sequence:CCGGCCCAGTATTTACTCAGGACATCTCGAGATGTCCTGAGTAAATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-1969s21c1
Sequence:CCGGACCGTCATGCTGCACCTAATCCTCGAGGATTAGGTGCAGCATGACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-91s21c1
Sequence:CCGGGAACCGATCCGCTACGCTATTCTCGAGAATAGCGTAGCGGATCGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018924
PCDHGB3 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-768s21c1
Sequence:CCGGCGCTGGCTCCTCCGTATTAAACTCGAGTTTAATACGGAGGAGCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-2388s1c1
Sequence:CCGGGCCTTCTAATTCAGGCAATTTCTCGAGAAATTGCCTGAATTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-302s1c1
Sequence:CCGGCGTGTGTTCTGGAATTTGAAACTCGAGTTTCAAATTCCAGAACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-198s1c1
Sequence:CCGGGCGGGTTATTGCAGAGAAGAACTCGAGTTCTTCTCTGCAATAACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-1245s1c1
Sequence:CCGGCCCAGAATACAATGTGACGATCTCGAGATCGTCACATTGTATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-717s1c1
Sequence:CCGGCCCAGTATTTACTCAGGACATCTCGAGATGTCCTGAGTAAATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-1969s21c1
Sequence:CCGGACCGTCATGCTGCACCTAATCCTCGAGGATTAGGTGCAGCATGACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-91s21c1
Sequence:CCGGGAACCGATCCGCTACGCTATTCTCGAGAATAGCGTAGCGGATCGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018924
PCDHGB3 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-768s21c1
Sequence:CCGGCGCTGGCTCCTCCGTATTAAACTCGAGTTTAATACGGAGGAGCCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-2388s1c1
Sequence:CCGGGCCTTCTAATTCAGGCAATTTCTCGAGAAATTGCCTGAATTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-302s1c1
Sequence:CCGGCGTGTGTTCTGGAATTTGAAACTCGAGTTTCAAATTCCAGAACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-198s1c1
Sequence:CCGGGCGGGTTATTGCAGAGAAGAACTCGAGTTCTTCTCTGCAATAACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-1245s1c1
Sequence:CCGGCCCAGAATACAATGTGACGATCTCGAGATCGTCACATTGTATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018924.2-717s1c1
Sequence:CCGGCCCAGTATTTACTCAGGACATCTCGAGATGTCCTGAGTAAATACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-1969s21c1
Sequence:CCGGACCGTCATGCTGCACCTAATCCTCGAGGATTAGGTGCAGCATGACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018924.2-91s21c1
Sequence:CCGGGAACCGATCCGCTACGCTATTCTCGAGAATAGCGTAGCGGATCGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)