EMAIL THIS PAGE TO A FRIEND

PCDHGB4

protocadherin gamma subfamily B, 4

46 Gene Product Result for
Synonyms: CDH20 FIB2 PCDH-GAMMA-B4
UniProtKB ID: Q9UN71, O15099, Q2M267, Q9UN64
Gene ID:
Human(8641) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. This particular family member is expressed in fibroblasts and is thought to play a role in wound healing in response to injury. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93701) protocadherin gamma subfamily B, 4
dog(607598) protocadherin gamma subfamily B, 4
domestic cat(101099175) protocadherin gamma subfamily B, 4
cow(532241) protocadherin gamma subfamily B, 4
sheep(101105911) protocadherin gamma subfamily B, 4
domestic guinea pig(100721092) protocadherin gamma subfamily B, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003736 Rosetta Predictions human pricing
NM_032098 Rosetta Predictions human pricing
NM_033576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195693 predicted 1173
2 SASI_Hs01_00195694 predicted 680
3 SASI_Hs01_00195695 predicted 672
4 SASI_Hs01_00195696 predicted 861
5 SASI_Hs01_00195697 predicted 1178
6 SASI_Hs01_00195698 predicted 719
7 SASI_Hs01_00195699 predicted 367
8 SASI_Hs01_00195700 predicted 614
9 SASI_Hs02_00336189 predicted 463
10 SASI_Hs01_00195701 predicted 926
11 SASI_Hs01_00195702 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171340 predicted 1171
2 SASI_Hs01_00171341 predicted 679
3 SASI_Hs01_00171342 predicted 671
4 SASI_Hs01_00171343 predicted 859
5 SASI_Hs01_00171344 predicted 1181
6 SASI_Hs01_00171345 predicted 716
7 SASI_Hs01_00171346 predicted 368
8 SASI_Hs01_00171347 predicted 613
9 SASI_Hs02_00359281 predicted 466
10 SASI_Hs01_00171348 predicted 929
11 SASI_Hs01_00171349 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060373 predicted 2598
2 SASI_Mm02_00337412 predicted 2643
3 SASI_Mm01_00060370 predicted 1791
4 SASI_Mm01_00060371 predicted 510
5 SASI_Mm01_00060372 predicted 711
6 SASI_Mm01_00060374 predicted 732
7 SASI_Mm01_00060375 predicted 1123
8 SASI_Mm01_00060377 predicted 863
9 SASI_Mm02_00337413 predicted 2120
10 SASI_Mm01_00060378 predicted 1188
11 SASI_Mm01_00060376 predicted 295
12 SASI_Mm01_00060379 predicted 2266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033576
PCDHGB4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033576.1-4168s1c1
Sequence:CCGGGCTGGTGTAGAATAGCCAATACTCGAGTATTGGCTATTCTACACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-559s1c1
Sequence:CCGGGACGGTAGTAAGTACCCTGAACTCGAGTTCAGGGTACTTACTACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-1239s1c1
Sequence:CCGGCCCGGAATACAACATTACTATCTCGAGATAGTAATGTTGTATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-561s1c1
Sequence:CCGGCGGTAGTAAGTACCCTGAAATCTCGAGATTTCAGGGTACTTACTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-399s1c1
Sequence:CCGGCGCGCACACTTCCTTTGAATTCTCGAGAATTCAAAGGAAGTGTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033576
PCDHGB4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033576.1-4168s1c1
Sequence:CCGGGCTGGTGTAGAATAGCCAATACTCGAGTATTGGCTATTCTACACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-559s1c1
Sequence:CCGGGACGGTAGTAAGTACCCTGAACTCGAGTTCAGGGTACTTACTACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-1239s1c1
Sequence:CCGGCCCGGAATACAACATTACTATCTCGAGATAGTAATGTTGTATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-561s1c1
Sequence:CCGGCGGTAGTAAGTACCCTGAAATCTCGAGATTTCAGGGTACTTACTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-399s1c1
Sequence:CCGGCGCGCACACTTCCTTTGAATTCTCGAGAATTCAAAGGAAGTGTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033576
PCDHGB4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033576.1-4168s1c1
Sequence:CCGGGCTGGTGTAGAATAGCCAATACTCGAGTATTGGCTATTCTACACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-559s1c1
Sequence:CCGGGACGGTAGTAAGTACCCTGAACTCGAGTTCAGGGTACTTACTACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-1239s1c1
Sequence:CCGGCCCGGAATACAACATTACTATCTCGAGATAGTAATGTTGTATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-561s1c1
Sequence:CCGGCGGTAGTAAGTACCCTGAAATCTCGAGATTTCAGGGTACTTACTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033576.1-399s1c1
Sequence:CCGGCGCGCACACTTCCTTTGAATTCTCGAGAATTCAAAGGAAGTGTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003736
PCDHGB4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1240s1c1
Sequence:CCGGCCAGAGTACAATATAACCGTTCTCGAGAACGGTTATATTGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-2183s1c1
Sequence:CCGGGTCTCTGTGTTAAATCCGAATCTCGAGATTCGGATTTAACACAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1449s1c1
Sequence:CCGGCCAAGTCTCTTACTGCATCATCTCGAGATGATGCAGTAAGAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-446s1c1
Sequence:CCGGGCACACGATTTATATTAGGATCTCGAGATCCTAATATAAATCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1041s1c1
Sequence:CCGGCCAGTCTCTACCCAACCTAATCTCGAGATTAGGTTGGGTAGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-720s21c1
Sequence:CCGGAGTGTTCAGTCAAGACGTATACTCGAGTATACGTCTTGACTGAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-817s21c1
Sequence:CCGGGTCAATGCCGAGATTACTTTCCTCGAGGAAAGTAATCTCGGCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-1153s21c1
Sequence:CCGGGAAGGTGATGTTCCATTTAAACTCGAGTTTAAATGGAACATCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003736
PCDHGB4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1240s1c1
Sequence:CCGGCCAGAGTACAATATAACCGTTCTCGAGAACGGTTATATTGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-2183s1c1
Sequence:CCGGGTCTCTGTGTTAAATCCGAATCTCGAGATTCGGATTTAACACAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1449s1c1
Sequence:CCGGCCAAGTCTCTTACTGCATCATCTCGAGATGATGCAGTAAGAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-446s1c1
Sequence:CCGGGCACACGATTTATATTAGGATCTCGAGATCCTAATATAAATCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1041s1c1
Sequence:CCGGCCAGTCTCTACCCAACCTAATCTCGAGATTAGGTTGGGTAGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-720s21c1
Sequence:CCGGAGTGTTCAGTCAAGACGTATACTCGAGTATACGTCTTGACTGAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-817s21c1
Sequence:CCGGGTCAATGCCGAGATTACTTTCCTCGAGGAAAGTAATCTCGGCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-1153s21c1
Sequence:CCGGGAAGGTGATGTTCCATTTAAACTCGAGTTTAAATGGAACATCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003736
PCDHGB4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1240s1c1
Sequence:CCGGCCAGAGTACAATATAACCGTTCTCGAGAACGGTTATATTGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-2183s1c1
Sequence:CCGGGTCTCTGTGTTAAATCCGAATCTCGAGATTCGGATTTAACACAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1449s1c1
Sequence:CCGGCCAAGTCTCTTACTGCATCATCTCGAGATGATGCAGTAAGAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-446s1c1
Sequence:CCGGGCACACGATTTATATTAGGATCTCGAGATCCTAATATAAATCGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003736.2-1041s1c1
Sequence:CCGGCCAGTCTCTACCCAACCTAATCTCGAGATTAGGTTGGGTAGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-720s21c1
Sequence:CCGGAGTGTTCAGTCAAGACGTATACTCGAGTATACGTCTTGACTGAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-817s21c1
Sequence:CCGGGTCAATGCCGAGATTACTTTCCTCGAGGAAAGTAATCTCGGCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003736.2-1153s21c1
Sequence:CCGGGAAGGTGATGTTCCATTTAAACTCGAGTTTAAATGGAACATCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)