EMAIL THIS PAGE TO A FRIEND

PCDHGB5

protocadherin gamma subfamily B, 5

62 Gene Product Result for
Synonyms: PCDH-GAMMA-B5
UniProtKB ID: Q9Y5G0, Q52LK8, Q9Y5C6
Gene ID:
Human(56101) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93702) protocadherin gamma subfamily B, 5
Rat(680448) protocadherin gamma subfamily B, 5
cow(101903816) protocadherin gamma subfamily B, 5
cow(100337166) protocadherin gamma subfamily B, 5
sheep(101103812) protocadherin gamma subfamily B, 5
chicken(776350) protocadherin gamma subfamily B, 5
Horse(100072229) protocadherin gamma subfamily B, 5
domestic cat(101099683) protocadherin gamma subfamily B, 5
dog(607624) protocadherin gamma subfamily B, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700117 Anti-PCDHGB5 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018925 Rosetta Predictions human pricing
NM_032099 Rosetta Predictions human pricing
XR_005755 Rosetta Predictions rat pricing
NM_033577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208514 predicted 921
2 SASI_Hs01_00208515 predicted 484
3 SASI_Hs01_00208517 predicted 918
4 SASI_Hs01_00208518 predicted 875
5 SASI_Hs01_00208519 predicted 437
6 SASI_Hs01_00208520 predicted 1358
7 SASI_Hs01_00208521 predicted 850
8 SASI_Hs01_00208522 predicted 615
9 SASI_Hs01_00208523 predicted 368
10 SASI_Hs02_00352374 predicted 719
11 SASI_Hs01_00208516 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046995 predicted 917
2 SASI_Hs01_00046996 predicted 481
3 SASI_Hs01_00046998 predicted 926
4 SASI_Hs01_00046999 predicted 882
5 SASI_Hs01_00047000 predicted 439
6 SASI_Hs01_00047001 predicted 1357
7 SASI_Hs01_00047002 predicted 848
8 SASI_Hs01_00047003 predicted 616
9 SASI_Hs01_00047004 predicted 369
10 SASI_Hs02_00359282 predicted 718
11 SASI_Hs01_00046997 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00410160 predicted 475
2 SASI_Rn02_00410161 predicted 476
3 SASI_Rn02_00410162 predicted 484
4 SASI_Rn02_00410163 predicted 371
5 SASI_Rn02_00410164 predicted 270
6 SASI_Rn02_00410165 predicted 381
7 SASI_Rn02_00410166 predicted 374
8 SASI_Rn02_00410167 predicted 267
9 SASI_Rn02_00410168 predicted 455
10 SASI_Rn02_00410169 predicted 337
11 SASI_Rn01_00167390 predicted 1214
12 SASI_Rn01_00167391 predicted 714
13 SASI_Rn01_00167392 predicted 1201
14 SASI_Rn01_00167393 predicted 1269
15 SASI_Rn01_00167394 predicted 1417
16 SASI_Rn01_00167395 predicted 2418
17 SASI_Rn01_00167396 predicted 1222
18 SASI_Rn01_00167397 predicted 2451
19 SASI_Rn01_00167398 predicted 1377
20 SASI_Rn01_00167399 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106512 predicted 2639
2 SASI_Mm02_00337414 predicted 2693
3 SASI_Mm02_00337415 predicted 970
4 SASI_Mm01_00106513 predicted 2230
5 SASI_Mm02_00337416 predicted 2664
6 SASI_Mm01_00106514 predicted 381
7 SASI_Mm01_00106515 predicted 2205
8 SASI_Mm01_00106516 predicted 1185
9 SASI_Mm01_00106517 predicted 2260
10 SASI_Mm01_00106518 predicted 618
11 SASI_Mm01_00106519 predicted 571
12 SASI_Mm01_00106520 predicted 879
13 SASI_Mm01_00106521 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018925
VALIDATED
PCDHGB5 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-467s21c1
Sequence:CCGGTAGCAGAAGATGCAGATATTGCTCGAGCAATATCTGCATCTTCTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-1293s21c1
Sequence:CCGGCATAAGCGTCATCCTACATATCTCGAGATATGTAGGATGACGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-693s21c1
Sequence:CCGGGGTAACCGACGCCAATGATAACTCGAGTTATCATTGGCGTCGGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-522s21c1
Sequence:CCGGTAACCCAAGTTTCTCATTAATCTCGAGATTAATGAGAAACTTGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-915s21c1
Sequence:CCGGTGAAGAGACCAAGGAATATTCCTCGAGGAATATTCCTTGGTCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-550s21c1
Sequence:CCGGGAGAAACAGGATGGTAGTAAACTCGAGTTTACTACCATCCTGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-972s21c1
Sequence:CCGGTGCACAATGTACAGTTGAAATCTCGAGATTTCAACTGTACATTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-881s1c1
Sequence:CCGGGCGGAGAAATTACCACTCAAACTCGAGTTTGAGTGGTAATTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1351s1c1
Sequence:CCGGGCGTCCTACTTAGTCAGTGTACTCGAGTACACTGACTAAGTAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-852s1c1
Sequence:CCGGCGGGCAAATCTTTAGTCTGAACTCGAGTTCAGACTAAAGATTTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-604s1c1
Sequence:CCGGCGGGAACAACAGAGTTACCATCTCGAGATGGTAACTCTGTTGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1071s1c1
Sequence:CCGGGCCTGGAACACTAATTGCTTTCTCGAGAAAGCAATTAGTGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018925
VALIDATED
PCDHGB5 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-467s21c1
Sequence:CCGGTAGCAGAAGATGCAGATATTGCTCGAGCAATATCTGCATCTTCTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-1293s21c1
Sequence:CCGGCATAAGCGTCATCCTACATATCTCGAGATATGTAGGATGACGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-693s21c1
Sequence:CCGGGGTAACCGACGCCAATGATAACTCGAGTTATCATTGGCGTCGGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-522s21c1
Sequence:CCGGTAACCCAAGTTTCTCATTAATCTCGAGATTAATGAGAAACTTGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-915s21c1
Sequence:CCGGTGAAGAGACCAAGGAATATTCCTCGAGGAATATTCCTTGGTCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-550s21c1
Sequence:CCGGGAGAAACAGGATGGTAGTAAACTCGAGTTTACTACCATCCTGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-972s21c1
Sequence:CCGGTGCACAATGTACAGTTGAAATCTCGAGATTTCAACTGTACATTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-881s1c1
Sequence:CCGGGCGGAGAAATTACCACTCAAACTCGAGTTTGAGTGGTAATTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1351s1c1
Sequence:CCGGGCGTCCTACTTAGTCAGTGTACTCGAGTACACTGACTAAGTAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-852s1c1
Sequence:CCGGCGGGCAAATCTTTAGTCTGAACTCGAGTTCAGACTAAAGATTTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-604s1c1
Sequence:CCGGCGGGAACAACAGAGTTACCATCTCGAGATGGTAACTCTGTTGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1071s1c1
Sequence:CCGGGCCTGGAACACTAATTGCTTTCTCGAGAAAGCAATTAGTGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018925
VALIDATED
PCDHGB5 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-467s21c1
Sequence:CCGGTAGCAGAAGATGCAGATATTGCTCGAGCAATATCTGCATCTTCTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-1293s21c1
Sequence:CCGGCATAAGCGTCATCCTACATATCTCGAGATATGTAGGATGACGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-693s21c1
Sequence:CCGGGGTAACCGACGCCAATGATAACTCGAGTTATCATTGGCGTCGGTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-522s21c1
Sequence:CCGGTAACCCAAGTTTCTCATTAATCTCGAGATTAATGAGAAACTTGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-915s21c1
Sequence:CCGGTGAAGAGACCAAGGAATATTCCTCGAGGAATATTCCTTGGTCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-550s21c1
Sequence:CCGGGAGAAACAGGATGGTAGTAAACTCGAGTTTACTACCATCCTGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018925.2-972s21c1
Sequence:CCGGTGCACAATGTACAGTTGAAATCTCGAGATTTCAACTGTACATTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-881s1c1
Sequence:CCGGGCGGAGAAATTACCACTCAAACTCGAGTTTGAGTGGTAATTTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1351s1c1
Sequence:CCGGGCGTCCTACTTAGTCAGTGTACTCGAGTACACTGACTAAGTAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-852s1c1
Sequence:CCGGCGGGCAAATCTTTAGTCTGAACTCGAGTTCAGACTAAAGATTTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018925.2-604s1c1
Sequence:CCGGCGGGAACAACAGAGTTACCATCTCGAGATGGTAACTCTGTTGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018925.2-1071s1c1
Sequence:CCGGGCCTGGAACACTAATTGCTTTCTCGAGAAAGCAATTAGTGTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033577
PCDHGB5 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033577.1-3291s1c1
Sequence:CCGGCCTCTCCTTCAGTTCAGCTTTCTCGAGAAAGCTGAACTGAAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1234s1c1
Sequence:CCGGCCAGAATACAATGTGACCATTCTCGAGAATGGTCACATTGTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-487s1c1
Sequence:CCGGGCCTTAAATTCGCTACAGAATCTCGAGATTCTGTAGCGAATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1351s1c1
Sequence:CCGGGCCTCCTACTTGGTGTACATACTCGAGTATGTACACCAAGTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-390s1c1
Sequence:CCGGGCCAAACTTCACGCACACTTTCTCGAGAAAGTGTGCGTGAAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033577
PCDHGB5 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033577.1-3291s1c1
Sequence:CCGGCCTCTCCTTCAGTTCAGCTTTCTCGAGAAAGCTGAACTGAAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1234s1c1
Sequence:CCGGCCAGAATACAATGTGACCATTCTCGAGAATGGTCACATTGTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-487s1c1
Sequence:CCGGGCCTTAAATTCGCTACAGAATCTCGAGATTCTGTAGCGAATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1351s1c1
Sequence:CCGGGCCTCCTACTTGGTGTACATACTCGAGTATGTACACCAAGTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-390s1c1
Sequence:CCGGGCCAAACTTCACGCACACTTTCTCGAGAAAGTGTGCGTGAAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033577
PCDHGB5 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033577.1-3291s1c1
Sequence:CCGGCCTCTCCTTCAGTTCAGCTTTCTCGAGAAAGCTGAACTGAAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1234s1c1
Sequence:CCGGCCAGAATACAATGTGACCATTCTCGAGAATGGTCACATTGTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-487s1c1
Sequence:CCGGGCCTTAAATTCGCTACAGAATCTCGAGATTCTGTAGCGAATTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-1351s1c1
Sequence:CCGGGCCTCCTACTTGGTGTACATACTCGAGTATGTACACCAAGTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033577.1-390s1c1
Sequence:CCGGGCCAAACTTCACGCACACTTTCTCGAGAAAGTGTGCGTGAAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)