EMAIL THIS PAGE TO A FRIEND

PCDHGB6

protocadherin gamma subfamily B, 6

120 Gene Product Result for
Synonyms: PCDH-GAMMA-B6
UniProtKB ID: Q9Y5F9, Q9Y5C5
Gene ID:
Human(56100) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93703) protocadherin gamma subfamily B, 6
Rat(680470) protocadherin gamma subfamily B, 6
Horse(100146747) protocadherin gamma subfamily B, 6
domestic cat(101099930) protocadherin gamma subfamily B, 6
dog(487183) protocadherin gamma subfamily B, 6
cow(100336046) protocadherin gamma subfamily B, 6
sheep(101104318) protocadherin gamma subfamily B, 6
domestic guinea pig(100722198) protocadherin gamma subfamily B, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407722 Anti-PCDHGB6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018926 Rosetta Predictions human pricing
NM_032100 Rosetta Predictions human pricing
XM_001057332 Rosetta Predictions rat pricing
NM_033578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018334 predicted 1021
2 SASI_Hs01_00018337 predicted 620
3 SASI_Hs01_00018338 predicted 429
4 SASI_Hs01_00018339 predicted 564
5 SASI_Hs01_00018340 predicted 530
6 SASI_Hs02_00352375 predicted 891
7 SASI_Hs01_00018341 predicted 263
8 SASI_Hs01_00018342 predicted 735
9 SASI_Hs01_00018343 predicted 293
10 SASI_Hs02_00352376 predicted 1027
11 SASI_Hs01_00018335 predicted 496
12 SASI_Hs01_00018336 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086120 predicted 1022
2 SASI_Hs01_00086123 predicted 624
3 SASI_Hs01_00086124 predicted 422
4 SASI_Hs01_00086125 predicted 559
5 SASI_Hs01_00086126 predicted 530
6 SASI_Hs02_00359283 predicted 890
7 SASI_Hs01_00086127 predicted 263
8 SASI_Hs01_00086128 predicted 735
9 SASI_Hs01_00086129 predicted 294
10 SASI_Hs02_00359284 predicted 1027
11 SASI_Hs01_00086121 predicted 502
12 SASI_Hs01_00086122 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286067 predicted 2516
2 SASI_Rn02_00286068 predicted 2504
3 SASI_Rn02_00286069 predicted 2586
4 SASI_Rn02_00286070 predicted 2499
5 SASI_Rn02_00286071 predicted 2458
6 SASI_Rn02_00286072 predicted 2463
7 SASI_Rn02_00286073 predicted 2626
8 SASI_Rn02_00286074 predicted 2444
9 SASI_Rn02_00286075 predicted 2360
10 SASI_Rn02_00286076 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020903 predicted 2805
2 SASI_Mm02_00337417 predicted 2851
3 SASI_Mm01_00020902 predicted 553
4 SASI_Mm01_00020904 predicted 1502
5 SASI_Mm01_00020905 predicted 575
6 SASI_Mm01_00020906 predicted 677
7 SASI_Mm01_00020907 predicted 1449
8 SASI_Mm01_00020908 predicted 622
9 SASI_Mm01_00020909 predicted 882
10 SASI_Mm01_00020910 predicted 506
11 SASI_Mm01_00020911 predicted 1264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018926
PCDHGB6 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-552s21c1
Sequence:CCGGTAATTCCGATGGTGGCAAATACTCGAGTATTTGCCACCATCGGAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2316s1c1
Sequence:CCGGCCTACATTCCAATGAAGACATCTCGAGATGTCTTCATTGGAATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-615s21c1
Sequence:CCGGGAGATCTCATAGCTTGATATTCTCGAGAATATCAAGCTATGAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-574s1c1
Sequence:CCGGCCAGAGTTATCTCTGGAGAAACTCGAGTTTCTCCAGAGATAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2264s1c1
Sequence:CCGGGCATTGCACATACGGGTACAACTCGAGTTGTACCCGTATGTGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-728s1c1
Sequence:CCGGGCAGAGACGAATATAGAATTACTCGAGTAATTCTATATTCGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-1289s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTAGAACTCGAGTTCTACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-438s21c1
Sequence:CCGGATCCGCTGGTACACGACTATCCTCGAGGATAGTCGTGTACCAGCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018926
PCDHGB6 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-552s21c1
Sequence:CCGGTAATTCCGATGGTGGCAAATACTCGAGTATTTGCCACCATCGGAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2316s1c1
Sequence:CCGGCCTACATTCCAATGAAGACATCTCGAGATGTCTTCATTGGAATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-615s21c1
Sequence:CCGGGAGATCTCATAGCTTGATATTCTCGAGAATATCAAGCTATGAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-574s1c1
Sequence:CCGGCCAGAGTTATCTCTGGAGAAACTCGAGTTTCTCCAGAGATAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2264s1c1
Sequence:CCGGGCATTGCACATACGGGTACAACTCGAGTTGTACCCGTATGTGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-728s1c1
Sequence:CCGGGCAGAGACGAATATAGAATTACTCGAGTAATTCTATATTCGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-1289s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTAGAACTCGAGTTCTACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-438s21c1
Sequence:CCGGATCCGCTGGTACACGACTATCCTCGAGGATAGTCGTGTACCAGCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018926
PCDHGB6 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-552s21c1
Sequence:CCGGTAATTCCGATGGTGGCAAATACTCGAGTATTTGCCACCATCGGAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2316s1c1
Sequence:CCGGCCTACATTCCAATGAAGACATCTCGAGATGTCTTCATTGGAATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-615s21c1
Sequence:CCGGGAGATCTCATAGCTTGATATTCTCGAGAATATCAAGCTATGAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-574s1c1
Sequence:CCGGCCAGAGTTATCTCTGGAGAAACTCGAGTTTCTCCAGAGATAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-2264s1c1
Sequence:CCGGGCATTGCACATACGGGTACAACTCGAGTTGTACCCGTATGTGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-728s1c1
Sequence:CCGGGCAGAGACGAATATAGAATTACTCGAGTAATTCTATATTCGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018926.2-1289s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTAGAACTCGAGTTCTACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018926.2-438s21c1
Sequence:CCGGATCCGCTGGTACACGACTATCCTCGAGGATAGTCGTGTACCAGCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033578
PCDHGB6 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily B, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033578.2-3970s1c1
Sequence:CCGGGACGACTTCTAAGTGAGTTTACTCGAGTAAACTCACTTAGAAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-970s1c1
Sequence:CCGGGCTGAGATACTTTACTACTTTCTCGAGAAAGTAGTAAAGTATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-535s1c1
Sequence:CCGGGCTCCTCAATTCGAGAAGAAACTCGAGTTTCTTCTCGAATTGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-560s1c1
Sequence:CCGGCGCGTTTAGAAATCTTAGAAACTCGAGTTTCTAAGATTTCTAAACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-1392s1c1
Sequence:CCGGCCCACAGTACAATGTCACCATCTCGAGATGGTGACATTGTACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033578
PCDHGB6 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily B, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033578.2-3970s1c1
Sequence:CCGGGACGACTTCTAAGTGAGTTTACTCGAGTAAACTCACTTAGAAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-970s1c1
Sequence:CCGGGCTGAGATACTTTACTACTTTCTCGAGAAAGTAGTAAAGTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-535s1c1
Sequence:CCGGGCTCCTCAATTCGAGAAGAAACTCGAGTTTCTTCTCGAATTGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-560s1c1
Sequence:CCGGCGCGTTTAGAAATCTTAGAAACTCGAGTTTCTAAGATTTCTAAACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-1392s1c1
Sequence:CCGGCCCACAGTACAATGTCACCATCTCGAGATGGTGACATTGTACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033578
PCDHGB6 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily B, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033578.2-3970s1c1
Sequence:CCGGGACGACTTCTAAGTGAGTTTACTCGAGTAAACTCACTTAGAAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-970s1c1
Sequence:CCGGGCTGAGATACTTTACTACTTTCTCGAGAAAGTAGTAAAGTATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-535s1c1
Sequence:CCGGGCTCCTCAATTCGAGAAGAAACTCGAGTTTCTTCTCGAATTGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-560s1c1
Sequence:CCGGCGCGTTTAGAAATCTTAGAAACTCGAGTTTCTAAGATTTCTAAACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033578.2-1392s1c1
Sequence:CCGGCCCACAGTACAATGTCACCATCTCGAGATGGTGACATTGTACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)