EMAIL THIS PAGE TO A FRIEND

PCDHGC3

protocadherin gamma subfamily C, 3

155 Gene Product Result for
Synonyms: PC43 PCDH-GAMMA-C3 PCDH2
UniProtKB ID: Q9UN70, O60622, Q08192, Q9Y5C4
Gene ID:
Human(5098) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93706) protocadherin gamma subfamily C, 3
Rat(116782) protocadherin gamma subfamily C, 3
chicken(408051) protocadherin gamma subfamily C, 3
dog(478038) protocadherin gamma subfamily C, 3
domestic cat(101101189) protocadherin gamma subfamily C, 3
Horse(100061444) protocadherin gamma subfamily C, 3
cow(100125301) protocadherin gamma subfamily C, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412408 ANTI-PCDHGC3 antibody produced in mouse clone 4F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA077289 Anti-PCDHGC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1404174 Monoclonal Anti-PCDHGC3 antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402299 Monoclonal Anti-PCDHGC3 antibody produced in mouse clone 3A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201671 Monoclonal Anti-Protocadherin Gamma C3 - Alkaline Phosphatase antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201672 Monoclonal Anti-Protocadherin Gamma C3 - Apc antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201663 Monoclonal Anti-Protocadherin Gamma C3 - Atto 390 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201664 Monoclonal Anti-Protocadherin Gamma C3 - Atto 488 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201665 Monoclonal Anti-Protocadherin Gamma C3 - Atto 565 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201666 Monoclonal Anti-Protocadherin Gamma C3 - Atto 594 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201667 Monoclonal Anti-Protocadherin Gamma C3 - Atto 633 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201668 Monoclonal Anti-Protocadherin Gamma C3 - Atto 655 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201669 Monoclonal Anti-Protocadherin Gamma C3 - Atto 680 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201670 Monoclonal Anti-Protocadherin Gamma C3 - Atto 700 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201673 Monoclonal Anti-Protocadherin Gamma C3 - Biotin antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201674 Monoclonal Anti-Protocadherin Gamma C3 - Fitc antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201675 Monoclonal Anti-Protocadherin Gamma C3 - Hrp antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201676 Monoclonal Anti-Protocadherin Gamma C3 - Pe/Atto 594 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201677 Monoclonal Anti-Protocadherin Gamma C3 - Percp antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201678 Monoclonal Anti-Protocadherin Gamma C3 - Rpe antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201679 Monoclonal Anti-Protocadherin Gamma C3 - Streptavidin antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing
SAB5201662 Monoclonal Anti-Protocadherin Gamma C3 antibody produced in mouse clone S174B-27, purified immunoglobulin mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002588 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225611 MISSION® esiRNA esiRNA targeting human PCDHGC3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002588 Rosetta Predictions human pricing
NM_032402 Rosetta Predictions human pricing
NM_032403 Rosetta Predictions human pricing
NM_053943 Rosetta Predictions rat pricing
NM_033581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101275 predicted 3325
2 SASI_Hs01_00101277 predicted 3346
3 SASI_Hs01_00101279 predicted 2988
4 SASI_Hs02_00334086 predicted 3296
5 SASI_Hs01_00101280 predicted 3185
6 SASI_Hs01_00101282 predicted 3343
7 SASI_Hs01_00101283 predicted 3139
8 SASI_Hs01_00101284 predicted 3390
9 SASI_Hs02_00334087 predicted 3171
10 SASI_Hs02_00334088 predicted 2992
11 SASI_Hs01_00101276 predicted 2790
12 SASI_Hs01_00101278 predicted 2803
13 SASI_Hs01_00101281 predicted 2836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359790 predicted 1008
2 SASI_Hs01_00023603 predicted 626
3 SASI_Hs01_00023604 predicted 1757
4 SASI_Hs01_00023606 predicted 1476
5 SASI_Hs01_00023607 predicted 1442
6 SASI_Hs01_00023608 predicted 1053
7 SASI_Hs01_00023609 predicted 604
8 SASI_Hs01_00023610 predicted 1067
9 SASI_Hs01_00023611 predicted 1487
10 SASI_Hs01_00023612 predicted 208
11 SASI_Hs01_00023605 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083690 predicted 923
2 SASI_Hs01_00083692 predicted 944
3 SASI_Hs01_00083694 predicted 591
4 SASI_Hs02_00359791 predicted 896
5 SASI_Hs01_00083695 predicted 781
6 SASI_Hs01_00083697 predicted 940
7 SASI_Hs01_00083698 predicted 735
8 SASI_Hs01_00083699 predicted 990
9 SASI_Hs02_00359792 predicted 770
10 SASI_Hs02_00359793 predicted 591
11 SASI_Hs01_00083691 predicted 390
12 SASI_Hs01_00083693 predicted 402
13 SASI_Hs01_00083696 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074466 predicted 2721
2 SASI_Rn01_00074467 predicted 277
3 SASI_Rn01_00074469 predicted 992
4 SASI_Rn01_00074470 predicted 1400
5 SASI_Rn01_00074471 predicted 554
6 SASI_Rn01_00074472 predicted 877
7 SASI_Rn01_00074473 predicted 1625
8 SASI_Rn01_00074474 predicted 560
9 SASI_Rn01_00074475 predicted 2133
10 SASI_Rn02_00266901 predicted 2198
11 SASI_Rn01_00074468 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182993 predicted 2801
2 SASI_Mm02_00337423 predicted 2846
3 SASI_Mm01_00182991 predicted 358
4 SASI_Mm01_00182992 predicted 1776
5 SASI_Mm01_00182995 predicted 1507
6 SASI_Mm01_00182996 predicted 2055
7 SASI_Mm02_00337424 predicted 1075
8 SASI_Mm01_00182997 predicted 1795
9 SASI_Mm01_00182998 predicted 1737
10 SASI_Mm01_00182999 predicted 1186
11 SASI_Mm01_00182994 predicted 1080
12 SASI_Mm01_00183000 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033581
VALIDATED
PCDHGC3 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily C, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-4371s1c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-1556s1c1
Sequence:CCGGGCGTTCCTATATTAAACCTAACTCGAGTTAGGTTTAATATAGGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-1332s1c1
Sequence:CCGGCCTGACTTCTTCCCTCAAGAACTCGAGTTCTTGAGGGAAGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-861s1c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-223s1c1
Sequence:CCGGGCTTCCACCATCATTCACTATCTCGAGATAGTGAATGATGGTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1736s21c1
Sequence:CCGGTCCAACTAACAGCTCATATAACTCGAGTTATATGAGCTGTTAGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033581.3-4371s21c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-861s21c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1010s21c1
Sequence:CCGGTGCGGGAACTATTCGCTTTAGCTCGAGCTAAAGCGAATAGTTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-696s21c1
Sequence:CCGGTCGAGAAGACGGCACGAAATACTCGAGTATTTCGTGCCGTCTTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033581
VALIDATED
PCDHGC3 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily C, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-4371s1c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-1556s1c1
Sequence:CCGGGCGTTCCTATATTAAACCTAACTCGAGTTAGGTTTAATATAGGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-1332s1c1
Sequence:CCGGCCTGACTTCTTCCCTCAAGAACTCGAGTTCTTGAGGGAAGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-861s1c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-223s1c1
Sequence:CCGGGCTTCCACCATCATTCACTATCTCGAGATAGTGAATGATGGTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1736s21c1
Sequence:CCGGTCCAACTAACAGCTCATATAACTCGAGTTATATGAGCTGTTAGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033581.3-4371s21c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-861s21c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1010s21c1
Sequence:CCGGTGCGGGAACTATTCGCTTTAGCTCGAGCTAAAGCGAATAGTTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-696s21c1
Sequence:CCGGTCGAGAAGACGGCACGAAATACTCGAGTATTTCGTGCCGTCTTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033581
VALIDATED
PCDHGC3 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily C, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-4371s1c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-1556s1c1
Sequence:CCGGGCGTTCCTATATTAAACCTAACTCGAGTTAGGTTTAATATAGGAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-1332s1c1
Sequence:CCGGCCTGACTTCTTCCCTCAAGAACTCGAGTTCTTGAGGGAAGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033581.2-861s1c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033581.2-223s1c1
Sequence:CCGGGCTTCCACCATCATTCACTATCTCGAGATAGTGAATGATGGTGGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1736s21c1
Sequence:CCGGTCCAACTAACAGCTCATATAACTCGAGTTATATGAGCTGTTAGTTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033581.3-4371s21c1
Sequence:CCGGCGCTGGTGTAGAATAGCCAATCTCGAGATTGGCTATTCTACACCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-861s21c1
Sequence:CCGGGCCTGCCTTCAATCAGTCTTTCTCGAGAAAGACTGATTGAAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-1010s21c1
Sequence:CCGGTGCGGGAACTATTCGCTTTAGCTCGAGCTAAAGCGAATAGTTCCCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033581.3-696s21c1
Sequence:CCGGTCGAGAAGACGGCACGAAATACTCGAGTATTTCGTGCCGTCTTCTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002588
VALIDATED
PCDHGC3 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily C, 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002588.2-943s1c1
Sequence:CCGGCGGTGAAATTATTTACTCCTTCTCGAGAAGGAGTAAATAATTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-2377s1c1
Sequence:CCGGGCACCTTTACCATCAGGTGTACTCGAGTACACCTGATGGTAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1430s1c1
Sequence:CCGGGCCCTTACAATAGTGCGTGTTCTCGAGAACACGCACTATTGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002588.2-526s1c1
Sequence:CCGGCCAGGAAATGAAATTGGAGATCTCGAGATCTCCAATTTCATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1633s21c1
Sequence:CCGGGGGTCGCTATTTCACAATAAACTCGAGTTTATTGTGAAATAGCGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1320s1c1
Sequence:CCGGCCCTCAAGAATTACTTCACTTCTCGAGAAGTGAAGTAATTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-626s21c1
Sequence:CCGGACCTATGAGCTGAGCCGAAATCTCGAGATTTCGGCTCAGCTCATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-2043s21c1
Sequence:CCGGCTCTCACGGTCTTGATCAAAGCTCGAGCTTTGATCAAGACCGTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1363s21c1
Sequence:CCGGTCGGGAGACTGTGCCAGAATACTCGAGTATTCTGGCACAGTCTCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-997s21c1
Sequence:CCGGATTCGCCTTAGACCTTGTAACCTCGAGGTTACAAGGTCTAAGGCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1489s21c1
Sequence:CCGGTCAATCTTCCTACGACGTTTACTCGAGTAAACGTCGTAGGAAGATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002588
VALIDATED
PCDHGC3 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily C, 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002588.2-943s1c1
Sequence:CCGGCGGTGAAATTATTTACTCCTTCTCGAGAAGGAGTAAATAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-2377s1c1
Sequence:CCGGGCACCTTTACCATCAGGTGTACTCGAGTACACCTGATGGTAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1430s1c1
Sequence:CCGGGCCCTTACAATAGTGCGTGTTCTCGAGAACACGCACTATTGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002588.2-526s1c1
Sequence:CCGGCCAGGAAATGAAATTGGAGATCTCGAGATCTCCAATTTCATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1633s21c1
Sequence:CCGGGGGTCGCTATTTCACAATAAACTCGAGTTTATTGTGAAATAGCGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1320s1c1
Sequence:CCGGCCCTCAAGAATTACTTCACTTCTCGAGAAGTGAAGTAATTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-626s21c1
Sequence:CCGGACCTATGAGCTGAGCCGAAATCTCGAGATTTCGGCTCAGCTCATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-2043s21c1
Sequence:CCGGCTCTCACGGTCTTGATCAAAGCTCGAGCTTTGATCAAGACCGTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1363s21c1
Sequence:CCGGTCGGGAGACTGTGCCAGAATACTCGAGTATTCTGGCACAGTCTCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-997s21c1
Sequence:CCGGATTCGCCTTAGACCTTGTAACCTCGAGGTTACAAGGTCTAAGGCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1489s21c1
Sequence:CCGGTCAATCTTCCTACGACGTTTACTCGAGTAAACGTCGTAGGAAGATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002588
VALIDATED
PCDHGC3 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily C, 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002588.2-943s1c1
Sequence:CCGGCGGTGAAATTATTTACTCCTTCTCGAGAAGGAGTAAATAATTTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-2377s1c1
Sequence:CCGGGCACCTTTACCATCAGGTGTACTCGAGTACACCTGATGGTAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1430s1c1
Sequence:CCGGGCCCTTACAATAGTGCGTGTTCTCGAGAACACGCACTATTGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002588.2-526s1c1
Sequence:CCGGCCAGGAAATGAAATTGGAGATCTCGAGATCTCCAATTTCATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1633s21c1
Sequence:CCGGGGGTCGCTATTTCACAATAAACTCGAGTTTATTGTGAAATAGCGACCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002588.2-1320s1c1
Sequence:CCGGCCCTCAAGAATTACTTCACTTCTCGAGAAGTGAAGTAATTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-626s21c1
Sequence:CCGGACCTATGAGCTGAGCCGAAATCTCGAGATTTCGGCTCAGCTCATAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-2043s21c1
Sequence:CCGGCTCTCACGGTCTTGATCAAAGCTCGAGCTTTGATCAAGACCGTGAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1363s21c1
Sequence:CCGGTCGGGAGACTGTGCCAGAATACTCGAGTATTCTGGCACAGTCTCCCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-997s21c1
Sequence:CCGGATTCGCCTTAGACCTTGTAACCTCGAGGTTACAAGGTCTAAGGCGAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002588.2-1489s21c1
Sequence:CCGGTCAATCTTCCTACGACGTTTACTCGAGTAAACGTCGTAGGAAGATTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)