EMAIL THIS PAGE TO A FRIEND

PCDHGC4

protocadherin gamma subfamily C, 4

122 Gene Product Result for
Synonyms: PCDH-GAMMA-C4
UniProtKB ID: Q9Y5F7, Q495T2, Q9Y5C3
Gene ID:
Human(56098) Summary: This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Mouse(93707) protocadherin gamma subfamily C, 4
Rat(641526) protocadherin gamma c4
sheep(101106426) protocadherin gamma subfamily C, 4
Horse(100061474) protocadherin gamma subfamily C, 4
domestic cat(101100440) protocadherin gamma subfamily C, 4
dog(100685766) protocadherin gamma subfamily C, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018928 Rosetta Predictions human pricing
NM_032406 Rosetta Predictions human pricing
NM_033582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114956 predicted 3218
2 SASI_Hs01_00114958 predicted 3238
3 SASI_Hs01_00114960 predicted 2884
4 SASI_Hs02_00352377 predicted 3191
5 SASI_Hs01_00114961 predicted 3079
6 SASI_Hs01_00114963 predicted 3240
7 SASI_Hs01_00114964 predicted 3031
8 SASI_Hs01_00114965 predicted 3287
9 SASI_Hs02_00352378 predicted 3065
10 SASI_Hs02_00352379 predicted 2884
11 SASI_Hs01_00114957 predicted 2686
12 SASI_Hs01_00114959 predicted 2706
13 SASI_Hs01_00114962 predicted 2730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055222 predicted 1912
2 SASI_Hs01_00055223 predicted 363
3 SASI_Hs01_00055224 predicted 2068
4 SASI_Hs02_00359796 predicted 1652
5 SASI_Hs01_00055226 predicted 1492
6 SASI_Hs01_00055227 predicted 497
7 SASI_Hs01_00055228 predicted 1800
8 SASI_Hs01_00055229 predicted 724
9 SASI_Hs02_00359797 predicted 215
10 SASI_Hs01_00055231 predicted 1848
11 SASI_Hs01_00055225 predicted 920
12 SASI_Hs01_00055230 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145516 predicted 3146
2 SASI_Mm02_00337425 predicted 3189
3 SASI_Mm02_00337426 predicted 1396
4 SASI_Mm02_00337427 predicted 1721
5 SASI_Mm02_00337428 predicted 1189
6 SASI_Mm02_00337429 predicted 2764
7 SASI_Mm02_00337430 predicted 1338
8 SASI_Mm02_00337431 predicted 531
9 SASI_Mm02_00337432 predicted 2253
10 SASI_Mm02_00337433 predicted 1962
11 SASI_Mm01_00145517 predicted 3162
12 SASI_Mm01_00145518 predicted 3249
13 SASI_Mm01_00145519 predicted 3192
14 SASI_Mm01_00145520 predicted 3234
15 SASI_Mm01_00145521 predicted 3177
16 SASI_Mm01_00145522 predicted 3175
17 SASI_Mm01_00145523 predicted 3233
18 SASI_Mm01_00145524 predicted 3270
19 SASI_Mm01_00145525 predicted 3148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018928
PCDHGC4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily C, 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-2267s21c1
Sequence:CCGGCAGATGACCCTATCAAGTTTGCTCGAGCAAACTTGATAGGGTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-860s21c1
Sequence:CCGGATCGTGTAAGAAACCTCTTTACTCGAGTAAAGAGGTTTCTTACACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1449s21c1
Sequence:CCGGCTCTGGCTTGAATGCGCTTATCTCGAGATAAGCGCATTCAAGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-355s1c1
Sequence:CCGGGCAGAGGTAGAGATCGTAGATCTCGAGATCTACGATCTCTACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1304s21c1
Sequence:CCGGTCAGTACCCACAGAACTATTTCTCGAGAAATAGTTCTGTGGGTACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-1640s1c1
Sequence:CCGGGCACTGTAACAGTTCGTCTATCTCGAGATAGACGAACTGTTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2413s1c1
Sequence:CCGGCCACCCTCTGATCTTCTCTATCTCGAGATAGAGAAGATCAGAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2095s1c1
Sequence:CCGGGCAATTTGCTTTGTCTCCTTTCTCGAGAAAGGAGACAAAGCAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-687s21c1
Sequence:CCGGGGTATCCGTGCTGGACGTAAACTCGAGTTTACGTCCAGCACGGATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-491s1c1
Sequence:CCGGGCAATTCGATTAGCAGCTATACTCGAGTATAGCTGCTAATCGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018928
PCDHGC4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily C, 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-2267s21c1
Sequence:CCGGCAGATGACCCTATCAAGTTTGCTCGAGCAAACTTGATAGGGTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-860s21c1
Sequence:CCGGATCGTGTAAGAAACCTCTTTACTCGAGTAAAGAGGTTTCTTACACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1449s21c1
Sequence:CCGGCTCTGGCTTGAATGCGCTTATCTCGAGATAAGCGCATTCAAGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-355s1c1
Sequence:CCGGGCAGAGGTAGAGATCGTAGATCTCGAGATCTACGATCTCTACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1304s21c1
Sequence:CCGGTCAGTACCCACAGAACTATTTCTCGAGAAATAGTTCTGTGGGTACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-1640s1c1
Sequence:CCGGGCACTGTAACAGTTCGTCTATCTCGAGATAGACGAACTGTTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2413s1c1
Sequence:CCGGCCACCCTCTGATCTTCTCTATCTCGAGATAGAGAAGATCAGAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2095s1c1
Sequence:CCGGGCAATTTGCTTTGTCTCCTTTCTCGAGAAAGGAGACAAAGCAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-687s21c1
Sequence:CCGGGGTATCCGTGCTGGACGTAAACTCGAGTTTACGTCCAGCACGGATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-491s1c1
Sequence:CCGGGCAATTCGATTAGCAGCTATACTCGAGTATAGCTGCTAATCGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018928
PCDHGC4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily C, 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-2267s21c1
Sequence:CCGGCAGATGACCCTATCAAGTTTGCTCGAGCAAACTTGATAGGGTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-860s21c1
Sequence:CCGGATCGTGTAAGAAACCTCTTTACTCGAGTAAAGAGGTTTCTTACACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1449s21c1
Sequence:CCGGCTCTGGCTTGAATGCGCTTATCTCGAGATAAGCGCATTCAAGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-355s1c1
Sequence:CCGGGCAGAGGTAGAGATCGTAGATCTCGAGATCTACGATCTCTACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-1304s21c1
Sequence:CCGGTCAGTACCCACAGAACTATTTCTCGAGAAATAGTTCTGTGGGTACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-1640s1c1
Sequence:CCGGGCACTGTAACAGTTCGTCTATCTCGAGATAGACGAACTGTTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2413s1c1
Sequence:CCGGCCACCCTCTGATCTTCTCTATCTCGAGATAGAGAAGATCAGAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-2095s1c1
Sequence:CCGGGCAATTTGCTTTGTCTCCTTTCTCGAGAAAGGAGACAAAGCAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018928.2-687s21c1
Sequence:CCGGGGTATCCGTGCTGGACGTAAACTCGAGTTTACGTCCAGCACGGATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018928.2-491s1c1
Sequence:CCGGGCAATTCGATTAGCAGCTATACTCGAGTATAGCTGCTAATCGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033582
VALIDATED
PCDHGC4 MISSION shRNA Bacterial Glycerol Stock
protocadherin gamma subfamily C, 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1636s1c1
Sequence:CCGGCCACTTACCATTTGCCCTCAACTCGAGTTGAGGGCAAATGGTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-3502s1c1
Sequence:CCGGCCTATTCAATCAGTGATTGTACTCGAGTACAATCACTGATTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1280s1c1
Sequence:CCGGCCTAGTGGTAACGTCACCTTTCTCGAGAAAGGTGACGTTACCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2010s1c1
Sequence:CCGGCCGTTCATGCTACTAGATCATCTCGAGATGATCTAGTAGCATGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2011s1c1
Sequence:CCGGCGTTCATGCTACTAGATCATTCTCGAGAATGATCTAGTAGCATGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033582
VALIDATED
PCDHGC4 MISSION shRNA shRNA Plasmid DNA
protocadherin gamma subfamily C, 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1636s1c1
Sequence:CCGGCCACTTACCATTTGCCCTCAACTCGAGTTGAGGGCAAATGGTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-3502s1c1
Sequence:CCGGCCTATTCAATCAGTGATTGTACTCGAGTACAATCACTGATTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1280s1c1
Sequence:CCGGCCTAGTGGTAACGTCACCTTTCTCGAGAAAGGTGACGTTACCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2010s1c1
Sequence:CCGGCCGTTCATGCTACTAGATCATCTCGAGATGATCTAGTAGCATGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2011s1c1
Sequence:CCGGCGTTCATGCTACTAGATCATTCTCGAGAATGATCTAGTAGCATGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033582
VALIDATED
PCDHGC4 MISSION shRNA Lentiviral Transduction Particles
protocadherin gamma subfamily C, 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1636s1c1
Sequence:CCGGCCACTTACCATTTGCCCTCAACTCGAGTTGAGGGCAAATGGTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-3502s1c1
Sequence:CCGGCCTATTCAATCAGTGATTGTACTCGAGTACAATCACTGATTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033582.2-1280s1c1
Sequence:CCGGCCTAGTGGTAACGTCACCTTTCTCGAGAAAGGTGACGTTACCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2010s1c1
Sequence:CCGGCCGTTCATGCTACTAGATCATCTCGAGATGATCTAGTAGCATGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033582.2-2011s1c1
Sequence:CCGGCGTTCATGCTACTAGATCATTCTCGAGAATGATCTAGTAGCATGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)