EMAIL THIS PAGE TO A FRIEND

PCDP1

47 Gene Product Result for
UniProtKB ID: Q4G0U5, B4DEK0, B4E2T5
Gene ID:
Rat(313149) primary ciliary dyskinesia protein 1
chicken(424272) primary ciliary dyskinesia protein 1
dog(476113) primary ciliary dyskinesia protein 1
cow(613775) primary ciliary dyskinesia protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029996 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118511 MISSION® esiRNA esiRNA human AC069154.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029996 Rosetta Predictions human pricing
XM_001054199 Rosetta Predictions rat pricing
XR_005664 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096745 predicted 1447
2 SASI_Hs01_00096746 predicted 1751
3 SASI_Hs01_00096747 predicted 1731
4 SASI_Hs01_00096748 predicted 1411
5 SASI_Hs01_00096749 predicted 1166
6 SASI_Hs01_00096750 predicted 2363
7 SASI_Hs01_00096752 predicted 1473
8 SASI_Hs01_00096753 predicted 1636
9 SASI_Hs02_00307595 predicted 1373
10 SASI_Hs02_00307596 predicted 2443
11 SASI_Hs01_00096744 predicted 1705
12 SASI_Hs01_00096751 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275040 predicted 368
2 SASI_Rn02_00275041 predicted 472
3 SASI_Rn02_00275042 predicted 1661
4 SASI_Rn02_00275043 predicted 796
5 SASI_Rn02_00275044 predicted 587
6 SASI_Rn02_00275045 predicted 821
7 SASI_Rn02_00275046 predicted 1930
8 SASI_Rn02_00275047 predicted 675
9 SASI_Rn02_00275048 predicted 2115
10 SASI_Rn02_00275049 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182034 predicted 592
2 SASI_Rn01_00182035 predicted 305
3 SASI_Rn01_00182036 predicted 498
4 SASI_Rn01_00182037 predicted 359
5 SASI_Rn01_00182038 predicted 436
6 SASI_Rn02_00409937 predicted 234
7 SASI_Rn01_00182039 predicted 503
8 SASI_Rn01_00182041 predicted 636
9 SASI_Rn01_00182042 predicted 542
10 SASI_Rn01_00182043 predicted 693
11 SASI_Rn01_00182040 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029996
PCDP1 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1897s21c1
Sequence:CCGGCTTGGACTGGTCCCAATTAAGCTCGAGCTTAATTGGGACCAGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029996.1-2380s1c1
Sequence:CCGGCCCGGAATAATGCACTGGAAACTCGAGTTTCCAGTGCATTATTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1740s21c1
Sequence:CCGGGATAGCACAAGAGGCGAATTTCTCGAGAAATTCGCCTCTTGTGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1647s21c1
Sequence:CCGGCATGATTCAGGGACGATTATTCTCGAGAATAATCGTCCCTGAATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029996.2-2767s21c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029996.1-2770s1c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-2365s21c1
Sequence:CCGGACGGACATTATTCCCGGAATACTCGAGTATTCCGGGAATAATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029996
PCDP1 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1897s21c1
Sequence:CCGGCTTGGACTGGTCCCAATTAAGCTCGAGCTTAATTGGGACCAGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029996.1-2380s1c1
Sequence:CCGGCCCGGAATAATGCACTGGAAACTCGAGTTTCCAGTGCATTATTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1740s21c1
Sequence:CCGGGATAGCACAAGAGGCGAATTTCTCGAGAAATTCGCCTCTTGTGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1647s21c1
Sequence:CCGGCATGATTCAGGGACGATTATTCTCGAGAATAATCGTCCCTGAATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029996.2-2767s21c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029996.1-2770s1c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-2365s21c1
Sequence:CCGGACGGACATTATTCCCGGAATACTCGAGTATTCCGGGAATAATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029996
PCDP1 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1897s21c1
Sequence:CCGGCTTGGACTGGTCCCAATTAAGCTCGAGCTTAATTGGGACCAGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029996.1-2380s1c1
Sequence:CCGGCCCGGAATAATGCACTGGAAACTCGAGTTTCCAGTGCATTATTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1740s21c1
Sequence:CCGGGATAGCACAAGAGGCGAATTTCTCGAGAAATTCGCCTCTTGTGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-1647s21c1
Sequence:CCGGCATGATTCAGGGACGATTATTCTCGAGAATAATCGTCCCTGAATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029996.2-2767s21c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029996.1-2770s1c1
Sequence:CCGGGTAGGTCAGTCCCTTCCATTTCTCGAGAAATGGAAGGGACTGACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029996.2-2365s21c1
Sequence:CCGGACGGACATTATTCCCGGAATACTCGAGTATTCCGGGAATAATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)