EMAIL THIS PAGE TO A FRIEND

PCF11

PCF11 cleavage and polyadenylation factor subunit

96 Gene Product Result for
UniProtKB ID: O94913, A6H8W7, O43671, Q6P0X8
Gene ID:
Mouse(74737) cleavage and polyadenylation factor subunit homolog (S. cerevisiae)
Rat(361605) PCF11 cleavage and polyadenylation factor subunit
Zebrafish(492341) cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
dog(476786) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
domestic cat(101099901) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
Horse(100061695) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
chicken(419021) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
sheep(101106469) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
domestic guinea pig(100733781) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
naked mole-rat(101717641) PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015885 Rosetta Predictions human pricing
XM_001062815 Rosetta Predictions rat pricing
XM_341883 Rosetta Predictions rat pricing
NM_029078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033979 predicted 564
2 SASI_Hs02_00348468 predicted 597
3 SASI_Hs01_00033981 predicted 909
4 SASI_Hs01_00033982 predicted 4324
5 SASI_Hs01_00033983 predicted 3730
6 SASI_Hs01_00033984 predicted 2623
7 SASI_Hs02_00348469 predicted 4275
8 SASI_Hs02_00348470 predicted 4185
9 SASI_Hs01_00033985 predicted 2477
10 SASI_Hs01_00033986 predicted 4344
11 SASI_Hs01_00033980 predicted 2234
12 SASI_Hs01_00033987 predicted 2085
13 SASI_Hs01_00033988 predicted 4425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304717 predicted 5161
2 SASI_Rn02_00304718 predicted 3755
3 SASI_Rn02_00304719 predicted 1404
4 SASI_Rn02_00304720 predicted 1635
5 SASI_Rn02_00304721 predicted 5255
6 SASI_Rn02_00304722 predicted 670
7 SASI_Rn02_00304723 predicted 5214
8 SASI_Rn02_00304724 predicted 4809
9 SASI_Rn02_00304725 predicted 2522
10 SASI_Rn02_00304726 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393533 predicted 2623
2 SASI_Rn02_00393534 predicted 5158
3 SASI_Rn02_00393535 predicted 3752
4 SASI_Rn02_00393536 predicted 1636
5 SASI_Rn02_00393537 predicted 5251
6 SASI_Rn02_00393538 predicted 666
7 SASI_Rn02_00393539 predicted 5221
8 SASI_Rn02_00393540 predicted 4813
9 SASI_Rn02_00393541 predicted 2524
10 SASI_Rn02_00393542 predicted 2544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092737 predicted 4667
2 SASI_Mm01_00092738 predicted 3189
3 SASI_Mm02_00334841 predicted 4276
4 SASI_Mm01_00092739 predicted 4237
5 SASI_Mm01_00092740 predicted 4686
6 SASI_Mm01_00092741 predicted 824
7 SASI_Mm01_00092742 predicted 486
8 SASI_Mm01_00092743 predicted 4401
9 SASI_Mm01_00092744 predicted 4648
10 SASI_Mm01_00092745 predicted 2802
11 SASI_Mm01_00092746 predicted 3646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029078
PCF11 MISSION shRNA Bacterial Glycerol Stock
PCF11 cleavage and polyadenylation factor subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029078.2-5038s21c1
Sequence:CCGGCAGGGCCTTCAGCTATCATTTCTCGAGAAATGATAGCTGAAGGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-1471s1c1
Sequence:CCGGCCACGATTAAAGAAGCATCTTCTCGAGAAGATGCTTCTTTAATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-4024s1c1
Sequence:CCGGCCCAAGGCATATCCTGATAATCTCGAGATTATCAGGATATGCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029078.2-5043s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-2332s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-826s1c1
Sequence:CCGGCCTCCCATTGTACCTGATATACTCGAGTATATCAGGTACAATGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-3642s21c1
Sequence:CCGGCAATCATTCTGGCCCATATAACTCGAGTTATATGGGCCAGAATGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-2499s21c1
Sequence:CCGGAGCTGAAGACCGACCATTATTCTCGAGAATAATGGTCGGTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-687s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-1827s21c1
Sequence:CCGGGATGCGTCAGTCGGGACTAAACTCGAGTTTAGTCCCGACTGACGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029078
PCF11 MISSION shRNA shRNA Plasmid DNA
PCF11 cleavage and polyadenylation factor subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029078.2-5038s21c1
Sequence:CCGGCAGGGCCTTCAGCTATCATTTCTCGAGAAATGATAGCTGAAGGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-1471s1c1
Sequence:CCGGCCACGATTAAAGAAGCATCTTCTCGAGAAGATGCTTCTTTAATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-4024s1c1
Sequence:CCGGCCCAAGGCATATCCTGATAATCTCGAGATTATCAGGATATGCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029078.2-5043s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-2332s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-826s1c1
Sequence:CCGGCCTCCCATTGTACCTGATATACTCGAGTATATCAGGTACAATGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-3642s21c1
Sequence:CCGGCAATCATTCTGGCCCATATAACTCGAGTTATATGGGCCAGAATGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-2499s21c1
Sequence:CCGGAGCTGAAGACCGACCATTATTCTCGAGAATAATGGTCGGTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-687s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-1827s21c1
Sequence:CCGGGATGCGTCAGTCGGGACTAAACTCGAGTTTAGTCCCGACTGACGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029078
PCF11 MISSION shRNA Lentiviral Transduction Particles
PCF11 cleavage and polyadenylation factor subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029078.2-5038s21c1
Sequence:CCGGCAGGGCCTTCAGCTATCATTTCTCGAGAAATGATAGCTGAAGGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-1471s1c1
Sequence:CCGGCCACGATTAAAGAAGCATCTTCTCGAGAAGATGCTTCTTTAATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-4024s1c1
Sequence:CCGGCCCAAGGCATATCCTGATAATCTCGAGATTATCAGGATATGCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029078.2-5043s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-2332s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029078.2-826s1c1
Sequence:CCGGCCTCCCATTGTACCTGATATACTCGAGTATATCAGGTACAATGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-3642s21c1
Sequence:CCGGCAATCATTCTGGCCCATATAACTCGAGTTATATGGGCCAGAATGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-2499s21c1
Sequence:CCGGAGCTGAAGACCGACCATTATTCTCGAGAATAATGGTCGGTCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-687s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029078.2-1827s21c1
Sequence:CCGGGATGCGTCAGTCGGGACTAAACTCGAGTTTAGTCCCGACTGACGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015885
PCF11 MISSION shRNA Bacterial Glycerol Stock
PCF11 cleavage and polyadenylation factor subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2337s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2518s1c1
Sequence:CCGGCGTTATTTGATGGACCTAGTACTCGAGTACTAGGTCCATCAAATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015885.2-5056s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-1434s21c1
Sequence:CCGGATCGAAATCGAAATCGAAATCCTCGAGGATTTCGATTTCGATTTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-768s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-3732s21c1
Sequence:CCGGCAATCAGACTGGTCCATATAACTCGAGTTATATGGACCAGTCTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-873s1c1
Sequence:CCGGCAACTAATAAGGCAGCAGTTACTCGAGTAACTGCTGCCTTATTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-2391s21c1
Sequence:CCGGCCTTGTTGTTGTGCATCAAATCTCGAGATTTGATGCACAACAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5396s21c1
Sequence:CCGGAGCAACCTCAACATAAGATTTCTCGAGAAATCTTATGTTGAGGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5424s21c1
Sequence:CCGGAGTAGCCTCCCACTGATTAAACTCGAGTTTAATCAGTGGGAGGCTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015885
PCF11 MISSION shRNA shRNA Plasmid DNA
PCF11 cleavage and polyadenylation factor subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2337s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2518s1c1
Sequence:CCGGCGTTATTTGATGGACCTAGTACTCGAGTACTAGGTCCATCAAATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015885.2-5056s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-1434s21c1
Sequence:CCGGATCGAAATCGAAATCGAAATCCTCGAGGATTTCGATTTCGATTTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-768s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-3732s21c1
Sequence:CCGGCAATCAGACTGGTCCATATAACTCGAGTTATATGGACCAGTCTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-873s1c1
Sequence:CCGGCAACTAATAAGGCAGCAGTTACTCGAGTAACTGCTGCCTTATTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-2391s21c1
Sequence:CCGGCCTTGTTGTTGTGCATCAAATCTCGAGATTTGATGCACAACAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5396s21c1
Sequence:CCGGAGCAACCTCAACATAAGATTTCTCGAGAAATCTTATGTTGAGGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5424s21c1
Sequence:CCGGAGTAGCCTCCCACTGATTAAACTCGAGTTTAATCAGTGGGAGGCTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015885
PCF11 MISSION shRNA Lentiviral Transduction Particles
PCF11 cleavage and polyadenylation factor subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2337s1c1
Sequence:CCGGCGACAGCTATTTCAGTATCAACTCGAGTTGATACTGAAATAGCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-2518s1c1
Sequence:CCGGCGTTATTTGATGGACCTAGTACTCGAGTACTAGGTCCATCAAATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015885.2-5056s1c1
Sequence:CCGGCCTTCAGCTATCATTTGGTTACTCGAGTAACCAAATGATAGCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-1434s21c1
Sequence:CCGGATCGAAATCGAAATCGAAATCCTCGAGGATTTCGATTTCGATTTCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-768s21c1
Sequence:CCGGAGATCCTGCTTGGCCTATTAACTCGAGTTAATAGGCCAAGCAGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-3732s21c1
Sequence:CCGGCAATCAGACTGGTCCATATAACTCGAGTTATATGGACCAGTCTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015885.2-873s1c1
Sequence:CCGGCAACTAATAAGGCAGCAGTTACTCGAGTAACTGCTGCCTTATTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015885.3-2391s21c1
Sequence:CCGGCCTTGTTGTTGTGCATCAAATCTCGAGATTTGATGCACAACAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5396s21c1
Sequence:CCGGAGCAACCTCAACATAAGATTTCTCGAGAAATCTTATGTTGAGGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015885.3-5424s21c1
Sequence:CCGGAGTAGCCTCCCACTGATTAAACTCGAGTTTAATCAGTGGGAGGCTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)