EMAIL THIS PAGE TO A FRIEND

PCGF2

polycomb group ring finger 2

90 Gene Product Result for
Synonyms: MEL-18 RNF110 ZNF144
UniProtKB ID: P35227, A6NGD8
Gene ID:
Human(7703) Summary: The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]
Mouse(22658) polycomb group ring finger 2
Rat(287662) polycomb group ring finger 2
domestic guinea pig(100719492) polycomb group ring finger 2
naked mole-rat(101721189) polycomb group ring finger 2
cow(505147) polycomb group ring finger 2
sheep(101120343) polycomb group ring finger 2
chicken(425919) polycomb group ring finger 2
domestic cat(101087022) polycomb group ring finger 2
Horse(100055282) polycomb group ring finger 2
dog(491035) polycomb group ring finger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007144 Rosetta Predictions human pricing
NM_001105836 Rosetta Predictions rat pricing
NM_009545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054493 predicted 796
2 SASI_Hs01_00054494 predicted 460
3 SASI_Hs01_00054495 predicted 440
4 SASI_Hs01_00054496 predicted 757
5 SASI_Hs01_00054497 predicted 746
6 SASI_Hs01_00054498 predicted 481
7 SASI_Hs01_00054499 predicted 517
8 SASI_Hs01_00054500 predicted 436
9 SASI_Hs02_00343035 predicted 1467
10 SASI_Hs02_00343036 predicted 374
11 SASI_Hs01_00054492 predicted 616
12 SASI_Hs01_00054501 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213006 predicted 208
2 SASI_Rn02_00213007 predicted 639
3 SASI_Rn02_00213008 predicted 255
4 SASI_Rn02_00213009 predicted 654
5 SASI_Rn02_00213010 predicted 677
6 SASI_Rn02_00213011 predicted 746
7 SASI_Rn02_00213012 predicted 889
8 SASI_Rn02_00213013 predicted 512
9 SASI_Rn02_00213014 predicted 287
10 SASI_Rn02_00213015 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082331 predicted 487
2 SASI_Mm01_00082332 predicted 790
3 SASI_Mm01_00082333 predicted 936
4 SASI_Mm01_00082334 predicted 540
5 SASI_Mm01_00082335 predicted 572
6 SASI_Mm01_00082336 predicted 1026
7 SASI_Mm01_00082337 predicted 403
8 SASI_Mm01_00082338 predicted 953
9 SASI_Mm01_00082339 predicted 787
10 SASI_Mm01_00082340 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007144
VALIDATED
PCGF2 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-840s1c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-441s1c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-409s1c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-867s1c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-525s1c1
Sequence:CCGGGCGGGATTTCTATGCAGCGTACTCGAGTACGCTGCATAGAAATCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-409s21c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-441s21c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-867s21c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-840s21c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007144
VALIDATED
PCGF2 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-840s1c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-441s1c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-409s1c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-867s1c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-525s1c1
Sequence:CCGGGCGGGATTTCTATGCAGCGTACTCGAGTACGCTGCATAGAAATCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-409s21c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-441s21c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-867s21c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-840s21c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007144
VALIDATED
PCGF2 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-840s1c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-441s1c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-409s1c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-867s1c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007144.2-525s1c1
Sequence:CCGGGCGGGATTTCTATGCAGCGTACTCGAGTACGCTGCATAGAAATCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-409s21c1
Sequence:CCGGTGTGACGTGCAGGTCCATAAACTCGAGTTTATGGACCTGCACGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-441s21c1
Sequence:CCGGGCTGAGCATCAGGTCTGACAACTCGAGTTGTCAGACCTGATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-867s21c1
Sequence:CCGGCATGGACATCGCCTACATCTACTCGAGTAGATGTAGGCGATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007144.2-840s21c1
Sequence:CCGGCGAGCCACTGAAGGAATACTACTCGAGTAGTATTCCTTCAGTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009545
VALIDATED
PCGF2 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-939s1c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-540s1c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1405s1c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1445s1c1
Sequence:CCGGACCCTCTCCTTCCGCAGCCATCTCGAGATGGCTGCGGAAGGAGAGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-605s1c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-605s21c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-939s21c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-1405s21c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-540s21c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009545
VALIDATED
PCGF2 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-939s1c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-540s1c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1405s1c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1445s1c1
Sequence:CCGGACCCTCTCCTTCCGCAGCCATCTCGAGATGGCTGCGGAAGGAGAGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-605s1c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-605s21c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-939s21c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-1405s21c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-540s21c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009545
VALIDATED
PCGF2 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-939s1c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-540s1c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1405s1c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-1445s1c1
Sequence:CCGGACCCTCTCCTTCCGCAGCCATCTCGAGATGGCTGCGGAAGGAGAGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009545.1-605s1c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-605s21c1
Sequence:CCGGGCTGAGCATCAGATCAGACAACTCGAGTTGTCTGATCTGATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-939s21c1
Sequence:CCGGGCAAAGTTCCTCCGCAACAAACTCGAGTTTGTTGCGGAGGAACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-1405s21c1
Sequence:CCGGTGACTGTTAATGGCGCTCCTTCTCGAGAAGGAGCGCCATTAACAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009545.1-540s21c1
Sequence:CCGGCGCTACTTGGAGACCAACAAACTCGAGTTTGTTGGTCTCCAAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)