EMAIL THIS PAGE TO A FRIEND

PCGF3

polycomb group ring finger 3

169 Gene Product Result for
Synonyms: DONG1 RNF3 RNF3A
UniProtKB ID: Q3KNV8, D3DVN1, O15262
Gene ID:
Human(10336) Summary: The protein encoded by this gene contains a C3HC4 type RING finger, which is a motif known to be involved in protein-protein interactions. The specific function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(69587) polycomb group ring finger 3
Rat(305624) polycomb group ring finger 3
chicken(427287) polycomb group ring finger 3
domestic cat(101094505) polycomb group ring finger 3
dog(612315) polycomb group ring finger 3
cow(615967) polycomb group ring finger 3
naked mole-rat(101703010) polycomb group ring finger 3
domestic guinea pig(100721042) polycomb group ring finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006315 Rosetta Predictions human pricing
NM_001107245 Rosetta Predictions rat pricing
NM_172716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136724 predicted 721
2 SASI_Hs01_00136725 predicted 1013
3 SASI_Hs01_00136726 predicted 398
4 SASI_Hs01_00136727 predicted 1036
5 SASI_Hs02_00341339 predicted 959
6 SASI_Hs01_00136728 predicted 570
7 SASI_Hs01_00136729 predicted 1268
8 SASI_Hs01_00136730 predicted 1013
9 SASI_Hs02_00341340 predicted 625
10 SASI_Hs01_00136732 predicted 570
11 SASI_Hs01_00136731 predicted 761
12 SASI_Hs01_00136733 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226935 predicted 405
2 SASI_Rn02_00226936 predicted 470
3 SASI_Rn02_00226937 predicted 490
4 SASI_Rn02_00226938 predicted 397
5 SASI_Rn02_00226939 predicted 474
6 SASI_Rn02_00226940 predicted 491
7 SASI_Rn02_00226941 predicted 408
8 SASI_Rn02_00226942 predicted 474
9 SASI_Rn02_00226943 predicted 465
10 SASI_Rn02_00226944 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179461 predicted 498
2 SASI_Mm01_00179462 predicted 944
3 SASI_Mm01_00179463 predicted 580
4 SASI_Mm01_00179464 predicted 498
5 SASI_Mm01_00179465 predicted 333
6 SASI_Mm02_00344509 predicted 1117
7 SASI_Mm01_00179466 predicted 496
8 SASI_Mm01_00179468 predicted 948
9 SASI_Mm01_00179469 predicted 678
10 SASI_Mm01_00179470 predicted 577
11 SASI_Mm01_00179467 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006315
VALIDATED
PCGF3 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-736s21c1
Sequence:CCGGTTCCCATCGGAATGGTGAAACCTCGAGGTTTCACCATTCCGATGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-952s21c1
Sequence:CCGGACTCAACCTTTCATCCTTTAACTCGAGTTAAAGGATGAAAGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006315.4-4426s21c1
Sequence:GTACCGGGTTTAGTGCACATAGCTAAATCTCGAGATTTAGCTATGTGCACTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-842s21c1
Sequence:CCGGAGCATCTGCCTGGAGTGTAACCTCGAGGTTACACTCCAGGCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006315.3-923s1c1
Sequence:CCGGCTGAAGAAGTTCATCGCCAAACTCGAGTTTGGCGATGAACTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-646s1c1
Sequence:CCGGGCAGAGGGAGTTCTATCACAACTCGAGTTGTGATAGAACTCCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-1066s1c1
Sequence:CCGGGCTGCACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-755s1c1
Sequence:CCGGGCAGACGACAGTTCAAACAAACTCGAGTTTGTTTGAACTGTCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-654s21c1
Sequence:CCGGAGAGGGAGTTCTATCACAAATCTCGAGATTTGTGATAGAACTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006315
VALIDATED
PCGF3 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-736s21c1
Sequence:CCGGTTCCCATCGGAATGGTGAAACCTCGAGGTTTCACCATTCCGATGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-952s21c1
Sequence:CCGGACTCAACCTTTCATCCTTTAACTCGAGTTAAAGGATGAAAGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006315.4-4426s21c1
Sequence:GTACCGGGTTTAGTGCACATAGCTAAATCTCGAGATTTAGCTATGTGCACTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-842s21c1
Sequence:CCGGAGCATCTGCCTGGAGTGTAACCTCGAGGTTACACTCCAGGCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006315.3-923s1c1
Sequence:CCGGCTGAAGAAGTTCATCGCCAAACTCGAGTTTGGCGATGAACTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-646s1c1
Sequence:CCGGGCAGAGGGAGTTCTATCACAACTCGAGTTGTGATAGAACTCCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-1066s1c1
Sequence:CCGGGCTGCACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-755s1c1
Sequence:CCGGGCAGACGACAGTTCAAACAAACTCGAGTTTGTTTGAACTGTCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-654s21c1
Sequence:CCGGAGAGGGAGTTCTATCACAAATCTCGAGATTTGTGATAGAACTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006315
VALIDATED
PCGF3 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-736s21c1
Sequence:CCGGTTCCCATCGGAATGGTGAAACCTCGAGGTTTCACCATTCCGATGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-952s21c1
Sequence:CCGGACTCAACCTTTCATCCTTTAACTCGAGTTAAAGGATGAAAGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006315.4-4426s21c1
Sequence:GTACCGGGTTTAGTGCACATAGCTAAATCTCGAGATTTAGCTATGTGCACTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-842s21c1
Sequence:CCGGAGCATCTGCCTGGAGTGTAACCTCGAGGTTACACTCCAGGCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006315.3-923s1c1
Sequence:CCGGCTGAAGAAGTTCATCGCCAAACTCGAGTTTGGCGATGAACTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-646s1c1
Sequence:CCGGGCAGAGGGAGTTCTATCACAACTCGAGTTGTGATAGAACTCCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-1066s1c1
Sequence:CCGGGCTGCACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006315.3-755s1c1
Sequence:CCGGGCAGACGACAGTTCAAACAAACTCGAGTTTGTTTGAACTGTCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006315.4-654s21c1
Sequence:CCGGAGAGGGAGTTCTATCACAAATCTCGAGATTTGTGATAGAACTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172716
VALIDATED
PCGF3 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-401s1c1
Sequence:CCGGGACTGAGTGTTTGCACACATTCTCGAGAATGTGTGCAAACACTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-895s1c1
Sequence:CCGGCCTCCTTTAATGAGCTGGACACTCGAGTGTCCAGCTCATTAAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-1004s1c1
Sequence:CCGGGCTACACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172716.2-501s1c1
Sequence:CCGGCCATTACAGTATATCGGTCATCTCGAGATGACCGATATACTGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-3529s1c1
Sequence:CCGGCCAGCTTTATTTACAGGCATACTCGAGTATGCCTGTAAATAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172716
VALIDATED
PCGF3 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-401s1c1
Sequence:CCGGGACTGAGTGTTTGCACACATTCTCGAGAATGTGTGCAAACACTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-895s1c1
Sequence:CCGGCCTCCTTTAATGAGCTGGACACTCGAGTGTCCAGCTCATTAAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-1004s1c1
Sequence:CCGGGCTACACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172716.2-501s1c1
Sequence:CCGGCCATTACAGTATATCGGTCATCTCGAGATGACCGATATACTGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-3529s1c1
Sequence:CCGGCCAGCTTTATTTACAGGCATACTCGAGTATGCCTGTAAATAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172716
VALIDATED
PCGF3 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-401s1c1
Sequence:CCGGGACTGAGTGTTTGCACACATTCTCGAGAATGTGTGCAAACACTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-895s1c1
Sequence:CCGGCCTCCTTTAATGAGCTGGACACTCGAGTGTCCAGCTCATTAAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-1004s1c1
Sequence:CCGGGCTACACTACAGACCCAAGATCTCGAGATCTTGGGTCTGTAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172716.2-501s1c1
Sequence:CCGGCCATTACAGTATATCGGTCATCTCGAGATGACCGATATACTGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172716.2-3529s1c1
Sequence:CCGGCCAGCTTTATTTACAGGCATACTCGAGTATGCCTGTAAATAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)