EMAIL THIS PAGE TO A FRIEND

PCGF5

polycomb group ring finger 5

256 Gene Product Result for
Synonyms: RNF159
UniProtKB ID: Q86SE9, B7Z892, D3DR33, Q6PK47, Q86TD0
Gene ID:
Mouse(76073) polycomb group ring finger 5
Rat(681178) polycomb group ring finger 5
domestic guinea pig(100733364) polycomb group ring finger 5
naked mole-rat(101720933) polycomb group ring finger 5
cow(528946) polycomb group ring finger 5
sheep(101123250) polycomb group ring finger 5
Goat(100861357) polycomb group ring finger 5
chicken(423796) polycomb group ring finger 5
domestic cat(101084232) polycomb group ring finger 5
dog(486794) polycomb group ring finger 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032373 Rosetta Predictions human pricing
NM_001129882 Rosetta Predictions rat pricing
XM_001060464 Rosetta Predictions rat pricing
XM_001060520 Rosetta Predictions rat pricing
NM_029508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012121 predicted 866
2 SASI_Hs01_00012122 predicted 597
3 SASI_Hs01_00012123 predicted 896
4 SASI_Hs01_00012124 predicted 1021
5 SASI_Hs01_00012125 predicted 968
6 SASI_Hs02_00359758 predicted 862
7 SASI_Hs01_00012127 predicted 830
8 SASI_Hs02_00359759 predicted 825
9 SASI_Hs01_00012128 predicted 1042
10 SASI_Hs01_00012130 predicted 1151
11 SASI_Hs01_00012126 predicted 455
12 SASI_Hs01_00012129 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255249 predicted 912
2 SASI_Rn02_00255250 predicted 1106
3 SASI_Rn02_00255251 predicted 490
4 SASI_Rn02_00255252 predicted 914
5 SASI_Rn02_00255253 predicted 481
6 SASI_Rn02_00255254 predicted 406
7 SASI_Rn02_00255255 predicted 355
8 SASI_Rn02_00255256 predicted 973
9 SASI_Rn02_00255257 predicted 759
10 SASI_Rn02_00255258 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296600 predicted 1433
2 SASI_Rn02_00296601 predicted 1231
3 SASI_Rn02_00296602 predicted 620
4 SASI_Rn02_00296603 predicted 1256
5 SASI_Rn02_00296604 predicted 612
6 SASI_Rn02_00296605 predicted 531
7 SASI_Rn02_00296606 predicted 451
8 SASI_Rn02_00296607 predicted 471
9 SASI_Rn02_00296608 predicted 1175
10 SASI_Rn02_00296609 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296802 predicted 1491
2 SASI_Rn02_00296803 predicted 1491
3 SASI_Rn02_00296804 predicted 611
4 SASI_Rn02_00296805 predicted 606
5 SASI_Rn02_00296806 predicted 531
6 SASI_Rn02_00296807 predicted 472
7 SASI_Rn02_00296808 predicted 1496
8 SASI_Rn02_00296809 predicted 450
9 SASI_Rn02_00296810 predicted 480
10 SASI_Rn02_00296811 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057360 predicted 378
2 SASI_Mm01_00057361 predicted 866
3 SASI_Mm01_00057363 predicted 937
4 SASI_Mm01_00057364 predicted 678
5 SASI_Mm01_00057365 predicted 362
6 SASI_Mm01_00057367 predicted 1002
7 SASI_Mm02_00335446 predicted 865
8 SASI_Mm01_00057368 predicted 821
9 SASI_Mm01_00057369 predicted 455
10 SASI_Mm02_00335447 predicted 631
11 SASI_Mm01_00057362 predicted 1074
12 SASI_Mm01_00057366 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029508
VALIDATED
PCGF5 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-845s1c1
Sequence:CCGGGCTGTGCAATGGTGAAATTATCTCGAGATAATTTCACCATTGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029508.1-771s1c1
Sequence:CCGGCGAGTTACTGTAGGAACTATTCTCGAGAATAGTTCCTACAGTAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-991s1c1
Sequence:CCGGGCTGAATGAATCCTGCACTATCTCGAGATAGTGCAGGATTCATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-769s1c1
Sequence:CCGGCACGAGTTACTGTAGGAACTACTCGAGTAGTTCCTACAGTAACTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-850s1c1
Sequence:CCGGGCAATGGTGAAATTATGGGAACTCGAGTTCCCATAATTTCACCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029508
VALIDATED
PCGF5 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-845s1c1
Sequence:CCGGGCTGTGCAATGGTGAAATTATCTCGAGATAATTTCACCATTGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029508.1-771s1c1
Sequence:CCGGCGAGTTACTGTAGGAACTATTCTCGAGAATAGTTCCTACAGTAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-991s1c1
Sequence:CCGGGCTGAATGAATCCTGCACTATCTCGAGATAGTGCAGGATTCATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-769s1c1
Sequence:CCGGCACGAGTTACTGTAGGAACTACTCGAGTAGTTCCTACAGTAACTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-850s1c1
Sequence:CCGGGCAATGGTGAAATTATGGGAACTCGAGTTCCCATAATTTCACCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029508
VALIDATED
PCGF5 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-845s1c1
Sequence:CCGGGCTGTGCAATGGTGAAATTATCTCGAGATAATTTCACCATTGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029508.1-771s1c1
Sequence:CCGGCGAGTTACTGTAGGAACTATTCTCGAGAATAGTTCCTACAGTAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-991s1c1
Sequence:CCGGGCTGAATGAATCCTGCACTATCTCGAGATAGTGCAGGATTCATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-769s1c1
Sequence:CCGGCACGAGTTACTGTAGGAACTACTCGAGTAGTTCCTACAGTAACTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029508.1-850s1c1
Sequence:CCGGGCAATGGTGAAATTATGGGAACTCGAGTTCCCATAATTTCACCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032373
VALIDATED
PCGF5 MISSION shRNA Bacterial Glycerol Stock
polycomb group ring finger 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-840s1c1
Sequence:CCGGGAAGGATCATACTATGGAATTCTCGAGAATTCCATAGTATGATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-1275s1c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-643s1c1
Sequence:CCGGCCACAAATTGCTATCTGTCTACTCGAGTAGACAGATAGCAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-978s1c1
Sequence:CCGGGTATCGACCAAGAATTGATTTCTCGAGAAATCAATTCTTGGTCGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032373.3-448s21c1
Sequence:CCGGCCTTACATTACCTGCTATATCCTCGAGGATATAGCAGGTAATGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-546s21c1
Sequence:CCGGCTTTGAAGATAGCAATGATTGCTCGAGCAATCATTGCTATCTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-1449s21c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-989s21c1
Sequence:CCGGTGCTGTGCAATGGTGAAATTACTCGAGTAATTTCACCATTGCACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-742s1c2
Sequence:CCGGCGTGTAACTGTGGGAACTATTCTCGAGAATAGTTCCCACAGTTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-870s21c1
Sequence:CCGGCAATGTAGTAAAGGGTTTAATCTCGAGATTAAACCCTTTACTACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032373
VALIDATED
PCGF5 MISSION shRNA shRNA Plasmid DNA
polycomb group ring finger 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-840s1c1
Sequence:CCGGGAAGGATCATACTATGGAATTCTCGAGAATTCCATAGTATGATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-1275s1c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-643s1c1
Sequence:CCGGCCACAAATTGCTATCTGTCTACTCGAGTAGACAGATAGCAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-978s1c1
Sequence:CCGGGTATCGACCAAGAATTGATTTCTCGAGAAATCAATTCTTGGTCGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032373.3-448s21c1
Sequence:CCGGCCTTACATTACCTGCTATATCCTCGAGGATATAGCAGGTAATGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-546s21c1
Sequence:CCGGCTTTGAAGATAGCAATGATTGCTCGAGCAATCATTGCTATCTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-1449s21c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-989s21c1
Sequence:CCGGTGCTGTGCAATGGTGAAATTACTCGAGTAATTTCACCATTGCACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-742s1c2
Sequence:CCGGCGTGTAACTGTGGGAACTATTCTCGAGAATAGTTCCCACAGTTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-870s21c1
Sequence:CCGGCAATGTAGTAAAGGGTTTAATCTCGAGATTAAACCCTTTACTACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032373
VALIDATED
PCGF5 MISSION shRNA Lentiviral Transduction Particles
polycomb group ring finger 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-840s1c1
Sequence:CCGGGAAGGATCATACTATGGAATTCTCGAGAATTCCATAGTATGATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032373.2-1275s1c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-643s1c1
Sequence:CCGGCCACAAATTGCTATCTGTCTACTCGAGTAGACAGATAGCAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-978s1c1
Sequence:CCGGGTATCGACCAAGAATTGATTTCTCGAGAAATCAATTCTTGGTCGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032373.3-448s21c1
Sequence:CCGGCCTTACATTACCTGCTATATCCTCGAGGATATAGCAGGTAATGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-546s21c1
Sequence:CCGGCTTTGAAGATAGCAATGATTGCTCGAGCAATCATTGCTATCTTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-1449s21c1
Sequence:CCGGGCCATGATTCACCCTTCTGAACTCGAGTTCAGAAGGGTGAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-989s21c1
Sequence:CCGGTGCTGTGCAATGGTGAAATTACTCGAGTAATTTCACCATTGCACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032373.2-742s1c2
Sequence:CCGGCGTGTAACTGTGGGAACTATTCTCGAGAATAGTTCCCACAGTTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032373.3-870s21c1
Sequence:CCGGCAATGTAGTAAAGGGTTTAATCTCGAGATTAAACCCTTTACTACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)