EMAIL THIS PAGE TO A FRIEND

PCID2

PCI domain containing 2

64 Gene Product Result for
Synonyms: F10
Gene ID:
Human(55795) Summary: PCID2 is expressed in immature and early-stage B lymphocytes and regulates expression of the mitotic checkpoint protein MAD2 (MAD2L1; MIM 601467) (Nakaya et al., 2010 [PubMed 20870947]
Mouse(234069) PCI domain containing 2
Rat(361182) PCI domain containing 2
cow(617943) PCI domain containing 2
sheep(101118884) PCI domain containing 2
domestic guinea pig(100713598) PCI domain containing 2
naked mole-rat(101703889) PCI domain containing 2
Domestic Rabbit(100355258) PCI domain containing 2
fruit fly(39306) PCI domain-containing protein 2
chicken(418745) PCI domain containing 2
dog(476994) PCI domain containing 2
Horse(100067141) PCI domain containing 2
domestic cat(101090832) PCI domain containing 2
Zebrafish(492509) PCI domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018386 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063101 MISSION® esiRNA esiRNA human PCID2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018386 Rosetta Predictions human pricing
XM_341465 Rosetta Predictions rat pricing
XR_009021 Rosetta Predictions rat pricing
NM_178708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181892 predicted 849
2 SASI_Hs01_00181893 predicted 555
3 SASI_Hs01_00181894 predicted 764
4 SASI_Hs01_00181895 predicted 661
5 SASI_Hs01_00181896 predicted 356
6 SASI_Hs01_00181897 predicted 1166
7 SASI_Hs01_00181899 predicted 332
8 SASI_Hs01_00181900 predicted 398
9 SASI_Hs01_00181901 predicted 390
10 SASI_Hs02_00351876 predicted 620
11 SASI_Hs01_00181898 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184846 predicted 1422
2 SASI_Rn01_00184847 predicted 892
3 SASI_Rn01_00184848 predicted 572
4 SASI_Rn01_00184849 predicted 1245
5 SASI_Rn01_00184850 predicted 680
6 SASI_Rn01_00184851 predicted 1457
7 SASI_Rn01_00184852 predicted 1089
8 SASI_Rn01_00184853 predicted 1160
9 SASI_Rn01_00184854 predicted 534
10 SASI_Rn01_00184855 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143856 predicted 1089
2 SASI_Rn01_00143857 predicted 545
3 SASI_Rn01_00143858 predicted 223
4 SASI_Rn01_00143859 predicted 903
5 SASI_Rn01_00143860 predicted 335
6 SASI_Rn01_00143861 predicted 2048
7 SASI_Rn01_00143862 predicted 1110
8 SASI_Rn01_00143863 predicted 746
9 SASI_Rn01_00143864 predicted 2027
10 SASI_Rn01_00143865 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099353 predicted 858
2 SASI_Mm02_00349212 predicted 1074
3 SASI_Mm02_00349213 predicted 1512
4 SASI_Mm01_00099355 predicted 876
5 SASI_Mm02_00349214 predicted 554
6 SASI_Mm01_00099356 predicted 1529
7 SASI_Mm01_00099357 predicted 1629
8 SASI_Mm01_00099359 predicted 1645
9 SASI_Mm02_00349215 predicted 1657
10 SASI_Mm01_00099360 predicted 1277
11 SASI_Mm01_00099354 predicted 1687
12 SASI_Mm01_00099358 predicted 1152
13 SASI_Mm01_00099361 predicted 1497
14 SASI_Mm01_00099362 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178708
VALIDATED
PCID2 MISSION shRNA Bacterial Glycerol Stock
PCI domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2312s1c2
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178708.2-824s1c1
Sequence:CCGGCGACTTCATAGAAGCGTACAACTCGAGTTGTACGCTTCTATGAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178708.2-683s1c1
Sequence:CCGGGTATCCTTTAAGCACCCTCATCTCGAGATGAGGGTGCTTAAAGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-789s1c1
Sequence:CCGGGCTCATTTAAGGTGTACCTATCTCGAGATAGGTACACCTTAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2158s1c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2241s21c1
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1042s21c1
Sequence:CCGGTCCTGGTGAACCAGCTATTTACTCGAGTAAATAGCTGGTTCACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1633s21c1
Sequence:CCGGTGATATACATGGGTCACATTACTCGAGTAATGTGACCCATGTATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-867s21c1
Sequence:CCGGGCACTTGACCTTCGGATATTTCTCGAGAAATATCCGAAGGTCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2087s21c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178708
VALIDATED
PCID2 MISSION shRNA shRNA Plasmid DNA
PCI domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2312s1c2
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178708.2-824s1c1
Sequence:CCGGCGACTTCATAGAAGCGTACAACTCGAGTTGTACGCTTCTATGAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178708.2-683s1c1
Sequence:CCGGGTATCCTTTAAGCACCCTCATCTCGAGATGAGGGTGCTTAAAGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-789s1c1
Sequence:CCGGGCTCATTTAAGGTGTACCTATCTCGAGATAGGTACACCTTAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2158s1c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2241s21c1
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1042s21c1
Sequence:CCGGTCCTGGTGAACCAGCTATTTACTCGAGTAAATAGCTGGTTCACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1633s21c1
Sequence:CCGGTGATATACATGGGTCACATTACTCGAGTAATGTGACCCATGTATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-867s21c1
Sequence:CCGGGCACTTGACCTTCGGATATTTCTCGAGAAATATCCGAAGGTCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2087s21c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178708
VALIDATED
PCID2 MISSION shRNA Lentiviral Transduction Particles
PCI domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2312s1c2
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178708.2-824s1c1
Sequence:CCGGCGACTTCATAGAAGCGTACAACTCGAGTTGTACGCTTCTATGAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178708.2-683s1c1
Sequence:CCGGGTATCCTTTAAGCACCCTCATCTCGAGATGAGGGTGCTTAAAGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-789s1c1
Sequence:CCGGGCTCATTTAAGGTGTACCTATCTCGAGATAGGTACACCTTAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178708.2-2158s1c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2241s21c1
Sequence:CCGGCCAGAGGATGTGTGTTTGATTCTCGAGAATCAAACACACATCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1042s21c1
Sequence:CCGGTCCTGGTGAACCAGCTATTTACTCGAGTAAATAGCTGGTTCACCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-1633s21c1
Sequence:CCGGTGATATACATGGGTCACATTACTCGAGTAATGTGACCCATGTATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178708.3-867s21c1
Sequence:CCGGGCACTTGACCTTCGGATATTTCTCGAGAAATATCCGAAGGTCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178708.3-2087s21c1
Sequence:CCGGCGAGTTCTTTACTGTCTGTTACTCGAGTAACAGACAGTAAAGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018386
VALIDATED
PCID2 MISSION shRNA Bacterial Glycerol Stock
PCI domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-816s1c1
Sequence:CCGGGCACAGAGAGTAACATACAAACTCGAGTTTGTATGTTACTCTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-225s1c1
Sequence:CCGGGCTCATTTAAGGTGCACTTATCTCGAGATAAGTGCACCTTAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018386.1-1585s1c1
Sequence:CCGGCTTCATTATATCTTCCAGGATCTCGAGATCCTGGAAGATATAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-817s1c1
Sequence:CCGGCACAGAGAGTAACATACAAATCTCGAGATTTGTATGTTACTCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-1572s1c1
Sequence:CCGGCACATGGTATGTTCTTCATTACTCGAGTAATGAAGAACATACCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1193s21c1
Sequence:CCGGGACACGTCAAAGGCTACATATCTCGAGATATGTAGCCTTTGACGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-826s21c1
Sequence:CCGGAGGATGATTCTGATCTATTTGCTCGAGCAAATAGATCAGAATCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1151s21c1
Sequence:CCGGTTGACGAAGTTCAGTGTATTCCTCGAGGAATACACTGAACTTCGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-623s21c1
Sequence:CCGGAGATCAACAAACTCCATTTATCTCGAGATAAATGGAGTTTGTTGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-416s21c1
Sequence:CCGGCGCTTGACCTTCGAGTGTTTGCTCGAGCAAACACTCGAAGGTCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018386.2-1389s21c1
Sequence:CCGGGGTTCCTGAAGGCTGTCTTTGCTCGAGCAAAGACAGCCTTCAGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-728s21c1
Sequence:CCGGTTGGACGCAAGGCTATGTTTGCTCGAGCAAACATAGCCTTGCGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018386
VALIDATED
PCID2 MISSION shRNA shRNA Plasmid DNA
PCI domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-816s1c1
Sequence:CCGGGCACAGAGAGTAACATACAAACTCGAGTTTGTATGTTACTCTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-225s1c1
Sequence:CCGGGCTCATTTAAGGTGCACTTATCTCGAGATAAGTGCACCTTAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018386.1-1585s1c1
Sequence:CCGGCTTCATTATATCTTCCAGGATCTCGAGATCCTGGAAGATATAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-817s1c1
Sequence:CCGGCACAGAGAGTAACATACAAATCTCGAGATTTGTATGTTACTCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-1572s1c1
Sequence:CCGGCACATGGTATGTTCTTCATTACTCGAGTAATGAAGAACATACCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1193s21c1
Sequence:CCGGGACACGTCAAAGGCTACATATCTCGAGATATGTAGCCTTTGACGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-826s21c1
Sequence:CCGGAGGATGATTCTGATCTATTTGCTCGAGCAAATAGATCAGAATCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1151s21c1
Sequence:CCGGTTGACGAAGTTCAGTGTATTCCTCGAGGAATACACTGAACTTCGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-623s21c1
Sequence:CCGGAGATCAACAAACTCCATTTATCTCGAGATAAATGGAGTTTGTTGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-416s21c1
Sequence:CCGGCGCTTGACCTTCGAGTGTTTGCTCGAGCAAACACTCGAAGGTCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018386.2-1389s21c1
Sequence:CCGGGGTTCCTGAAGGCTGTCTTTGCTCGAGCAAAGACAGCCTTCAGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-728s21c1
Sequence:CCGGTTGGACGCAAGGCTATGTTTGCTCGAGCAAACATAGCCTTGCGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018386
VALIDATED
PCID2 MISSION shRNA Lentiviral Transduction Particles
PCI domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-816s1c1
Sequence:CCGGGCACAGAGAGTAACATACAAACTCGAGTTTGTATGTTACTCTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-225s1c1
Sequence:CCGGGCTCATTTAAGGTGCACTTATCTCGAGATAAGTGCACCTTAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167290    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018386.1-1585s1c1
Sequence:CCGGCTTCATTATATCTTCCAGGATCTCGAGATCCTGGAAGATATAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-817s1c1
Sequence:CCGGCACAGAGAGTAACATACAAATCTCGAGATTTGTATGTTACTCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018386.1-1572s1c1
Sequence:CCGGCACATGGTATGTTCTTCATTACTCGAGTAATGAAGAACATACCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1193s21c1
Sequence:CCGGGACACGTCAAAGGCTACATATCTCGAGATATGTAGCCTTTGACGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-826s21c1
Sequence:CCGGAGGATGATTCTGATCTATTTGCTCGAGCAAATAGATCAGAATCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-1151s21c1
Sequence:CCGGTTGACGAAGTTCAGTGTATTCCTCGAGGAATACACTGAACTTCGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-623s21c1
Sequence:CCGGAGATCAACAAACTCCATTTATCTCGAGATAAATGGAGTTTGTTGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-416s21c1
Sequence:CCGGCGCTTGACCTTCGAGTGTTTGCTCGAGCAAACACTCGAAGGTCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018386.2-1389s21c1
Sequence:CCGGGGTTCCTGAAGGCTGTCTTTGCTCGAGCAAAGACAGCCTTCAGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018386.2-728s21c1
Sequence:CCGGTTGGACGCAAGGCTATGTTTGCTCGAGCAAACATAGCCTTGCGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)