EMAIL THIS PAGE TO A FRIEND

PCIF1

PDX1 C-terminal inhibiting factor 1

79 Gene Product Result for
Synonyms: C20orf67
UniProtKB ID: Q9H4Z3, E1P5P1, Q54AB9, Q9NT85
Gene ID:
Mouse(228866) PDX1 C-terminal inhibiting factor 1
Rat(362269) PDX1 C-terminal inhibiting factor 1
Zebrafish(553360) PDX1 C-terminal inhibiting factor 1
chicken(771963) PDX1 C-terminal inhibiting factor 1
dog(477249) PDX1 C-terminal inhibiting factor 1
Horse(100056554) PDX1 C-terminal inhibiting factor 1
domestic cat(101084697) PDX1 C-terminal inhibiting factor 1
Domestic Rabbit(100348351) PDX1 C-terminal inhibiting factor 1
naked mole-rat(101717594) PDX1 C-terminal inhibiting factor 1
domestic guinea pig(100721320) PDX1 C-terminal inhibiting factor 1
cow(535479) PDX1 C-terminal inhibiting factor 1
sheep(101113874) PDX1 C-terminal inhibiting factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022104 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022104 Rosetta Predictions human pricing
NM_001108605 Rosetta Predictions rat pricing
NM_146129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224013 predicted 485
2 SASI_Hs02_00355493 predicted 2118
3 SASI_Hs01_00224014 predicted 598
4 SASI_Hs01_00224015 predicted 1126
5 SASI_Hs01_00224016 predicted 1819
6 SASI_Hs01_00224017 predicted 1269
7 SASI_Hs01_00224018 predicted 2185
8 SASI_Hs01_00224019 predicted 1067
9 SASI_Hs01_00224020 predicted 2204
10 SASI_Hs01_00224021 predicted 1225
11 SASI_Hs01_00224022 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240279 predicted 1688
2 SASI_Rn02_00240280 predicted 1543
3 SASI_Rn02_00240281 predicted 2779
4 SASI_Rn02_00240282 predicted 2920
5 SASI_Rn02_00240283 predicted 2264
6 SASI_Rn02_00240284 predicted 2242
7 SASI_Rn02_00240285 predicted 1801
8 SASI_Rn02_00240286 predicted 2466
9 SASI_Rn02_00240287 predicted 2273
10 SASI_Rn02_00240288 predicted 3210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044289 predicted 489
2 SASI_Mm01_00044290 predicted 1090
3 SASI_Mm02_00341803 predicted 771
4 SASI_Mm01_00044292 predicted 1986
5 SASI_Mm01_00044293 predicted 694
6 SASI_Mm01_00044294 predicted 1705
7 SASI_Mm02_00341804 predicted 1100
8 SASI_Mm01_00044295 predicted 1076
9 SASI_Mm01_00044296 predicted 1134
10 SASI_Mm01_00044297 predicted 1080
11 SASI_Mm01_00044291 predicted 596
12 SASI_Mm01_00044298 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022104
VALIDATED
PCIF1 MISSION shRNA Bacterial Glycerol Stock
PDX1 C-terminal inhibiting factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-851s21c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-1033s1c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1245s1c1
Sequence:CCGGGTGGTCAAATGGAATGTGGAACTCGAGTTCCACATTCCATTTGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1998s1c1
Sequence:CCGGGATGCCATGGTCTCTCACTTTCTCGAGAAAGTGAGAGACCATGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-490s1c1
Sequence:CCGGGTCCCTACTACTTCAACCGATCTCGAGATCGGTTGAAGTAGTAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1120s21c1
Sequence:CCGGACGACATTCCTATCAGGTTATCTCGAGATAACCTGATAGGAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-851s1c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-554s1c1
Sequence:CCGGCGATGTGATTTCGGACCCTTTCTCGAGAAAGGGTCCGAAATCACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022104.3-2525s21c1
Sequence:CCGGATATGAAGATTATGGTTCTGCCTCGAGGCAGAACCATAATCTTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1592s21c1
Sequence:CCGGCGTGGTCTGCATCCGGTATAACTCGAGTTATACCGGATGCAGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-1033s21c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022104
VALIDATED
PCIF1 MISSION shRNA shRNA Plasmid DNA
PDX1 C-terminal inhibiting factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-851s21c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-1033s1c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1245s1c1
Sequence:CCGGGTGGTCAAATGGAATGTGGAACTCGAGTTCCACATTCCATTTGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1998s1c1
Sequence:CCGGGATGCCATGGTCTCTCACTTTCTCGAGAAAGTGAGAGACCATGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-490s1c1
Sequence:CCGGGTCCCTACTACTTCAACCGATCTCGAGATCGGTTGAAGTAGTAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1120s21c1
Sequence:CCGGACGACATTCCTATCAGGTTATCTCGAGATAACCTGATAGGAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-851s1c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-554s1c1
Sequence:CCGGCGATGTGATTTCGGACCCTTTCTCGAGAAAGGGTCCGAAATCACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022104.3-2525s21c1
Sequence:CCGGATATGAAGATTATGGTTCTGCCTCGAGGCAGAACCATAATCTTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1592s21c1
Sequence:CCGGCGTGGTCTGCATCCGGTATAACTCGAGTTATACCGGATGCAGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-1033s21c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022104
VALIDATED
PCIF1 MISSION shRNA Lentiviral Transduction Particles
PDX1 C-terminal inhibiting factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-851s21c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-1033s1c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1245s1c1
Sequence:CCGGGTGGTCAAATGGAATGTGGAACTCGAGTTCCACATTCCATTTGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-1998s1c1
Sequence:CCGGGATGCCATGGTCTCTCACTTTCTCGAGAAAGTGAGAGACCATGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022104.3-490s1c1
Sequence:CCGGGTCCCTACTACTTCAACCGATCTCGAGATCGGTTGAAGTAGTAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1120s21c1
Sequence:CCGGACGACATTCCTATCAGGTTATCTCGAGATAACCTGATAGGAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-851s1c1
Sequence:CCGGCATCCAGACCAATGCTGTCATCTCGAGATGACAGCATTGGTCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022104.3-554s1c1
Sequence:CCGGCGATGTGATTTCGGACCCTTTCTCGAGAAAGGGTCCGAAATCACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022104.3-2525s21c1
Sequence:CCGGATATGAAGATTATGGTTCTGCCTCGAGGCAGAACCATAATCTTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022104.3-1592s21c1
Sequence:CCGGCGTGGTCTGCATCCGGTATAACTCGAGTTATACCGGATGCAGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022104.3-1033s21c1
Sequence:CCGGGCAAGGTGGTAGACAAAGGATCTCGAGATCCTTTGTCTACCACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146129
VALIDATED
PCIF1 MISSION shRNA Bacterial Glycerol Stock
PDX1 C-terminal inhibiting factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-2531s1c1
Sequence:CCGGGCCAGGGACATAGGAATATTACTCGAGTAATATTCCTATGTCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1090s1c1
Sequence:CCGGCCATCCATGTTTCGTGAAATTCTCGAGAATTTCACGAAACATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1091s1c1
Sequence:CCGGCATCCATGTTTCGTGAAATTACTCGAGTAATTTCACGAAACATGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1891s1c1
Sequence:CCGGCCTGACACAGATGGCTACTTTCTCGAGAAAGTAGCCATCTGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1726s1c1
Sequence:CCGGCGCCGATATCAGATGATGTTTCTCGAGAAACATCATCTGATATCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146129
VALIDATED
PCIF1 MISSION shRNA shRNA Plasmid DNA
PDX1 C-terminal inhibiting factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-2531s1c1
Sequence:CCGGGCCAGGGACATAGGAATATTACTCGAGTAATATTCCTATGTCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1090s1c1
Sequence:CCGGCCATCCATGTTTCGTGAAATTCTCGAGAATTTCACGAAACATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1091s1c1
Sequence:CCGGCATCCATGTTTCGTGAAATTACTCGAGTAATTTCACGAAACATGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1891s1c1
Sequence:CCGGCCTGACACAGATGGCTACTTTCTCGAGAAAGTAGCCATCTGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1726s1c1
Sequence:CCGGCGCCGATATCAGATGATGTTTCTCGAGAAACATCATCTGATATCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146129
VALIDATED
PCIF1 MISSION shRNA Lentiviral Transduction Particles
PDX1 C-terminal inhibiting factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-2531s1c1
Sequence:CCGGGCCAGGGACATAGGAATATTACTCGAGTAATATTCCTATGTCCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1090s1c1
Sequence:CCGGCCATCCATGTTTCGTGAAATTCTCGAGAATTTCACGAAACATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1091s1c1
Sequence:CCGGCATCCATGTTTCGTGAAATTACTCGAGTAATTTCACGAAACATGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1891s1c1
Sequence:CCGGCCTGACACAGATGGCTACTTTCTCGAGAAAGTAGCCATCTGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146129.2-1726s1c1
Sequence:CCGGCGCCGATATCAGATGATGTTTCTCGAGAAACATCATCTGATATCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)