EMAIL THIS PAGE TO A FRIEND

PCK2

phosphoenolpyruvate carboxykinase 2 (mitochondrial)

88 Gene Product Result for
Synonyms: PEPCK PEPCK-M PEPCK2
UniProtKB ID: Q16822, O43253, Q86U01, Q9BV62
Gene ID:
Human(5106) Summary: This gene encodes a member of the phosphoenolpyruvate carboxykinase (GTP) family. The protein is a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of GTP. A cytosolic form encoded by a different gene has also been characterized and is the key enzyme of gluconeogenesis in the liver. The encoded protein may serve a similar function, although it is constitutively expressed and not modulated by hormones such as glucagon and insulin that regulate the cytosolic form. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Mouse(74551) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Rat(361042) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
naked mole-rat(101706336) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
domestic guinea pig(100715252) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
cow(282856) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
sheep(100302625) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
sheep(101120669) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Thale Cress(836696) phosphoenolpyruvate carboxykinase 2
chicken(396457) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
dog(480255) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
domestic cat(101098874) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Horse(100054903) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Zebrafish(406473) phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
K3890 Anti-PCK2 (611-625) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K4015 Anti-PCK2 (96-110) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300459 Anti-PCK2 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300458 Anti-PCK2 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1406227 Anti-PCK2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA051162 Anti-PCK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA053502 Anti-PCK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500760 Anti-PCK2/PEPCK-M antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1402300 Monoclonal Anti-PCK2 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018073 Rosetta Predictions human pricing
NM_004563 Rosetta Predictions human pricing
NM_001108377 Rosetta Predictions rat pricing
NM_028994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042913 predicted 1090
2 SASI_Hs02_00306972 predicted 331
3 SASI_Hs01_00042914 predicted 1125
4 SASI_Hs01_00042915 predicted 446
5 SASI_Hs01_00042916 predicted 589
6 SASI_Hs01_00042917 predicted 428
7 SASI_Hs01_00042918 predicted 667
8 SASI_Hs01_00042919 predicted 582
9 SASI_Hs01_00042920 predicted 442
10 SASI_Hs01_00042921 predicted 902
11 SASI_Hs01_00042912 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116481 predicted 1082
2 SASI_Hs02_00337889 predicted 332
3 SASI_Hs01_00116482 predicted 1124
4 SASI_Hs01_00116483 predicted 440
5 SASI_Hs01_00116484 predicted 591
6 SASI_Hs01_00116485 predicted 425
7 SASI_Hs01_00116486 predicted 667
8 SASI_Hs01_00116487 predicted 577
9 SASI_Hs01_00116488 predicted 442
10 SASI_Hs01_00116489 predicted 901
11 SASI_Hs01_00116480 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238069 predicted 1097
2 SASI_Rn02_00238070 predicted 1431
3 SASI_Rn02_00238071 predicted 1559
4 SASI_Rn02_00238072 predicted 1607
5 SASI_Rn02_00238073 predicted 1674
6 SASI_Rn02_00238074 predicted 389
7 SASI_Rn02_00238075 predicted 1224
8 SASI_Rn02_00238076 predicted 270
9 SASI_Rn02_00238077 predicted 1508
10 SASI_Rn02_00238078 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043651 predicted 1216
2 SASI_Mm02_00334723 predicted 1542
3 SASI_Mm01_00043653 predicted 508
4 SASI_Mm01_00043654 predicted 1793
5 SASI_Mm01_00043655 predicted 1327
6 SASI_Mm01_00043656 predicted 679
7 SASI_Mm01_00043657 predicted 1443
8 SASI_Mm01_00043658 predicted 1727
9 SASI_Mm01_00043659 predicted 1857
10 SASI_Mm01_00043660 predicted 1315
11 SASI_Mm01_00043652 predicted 2210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004563
VALIDATED
PCK2 MISSION shRNA Bacterial Glycerol Stock
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-252s21c1
Sequence:GTACCGGTCCCACTGGCATTCGAGATTTCTCGAGAAATCTCGAATGCCAGTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-445s21c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-2065s21c1
Sequence:CCGGCTAGTCTAGCAAGAGGACATACTCGAGTATGTCCTCTTGCTAGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-684s21c1
Sequence:CCGGGGTGGCAAGCATGCGTATTATCTCGAGATAATACGCATGCTTGCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-1384s21c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1580s21c1
Sequence:CCGGCTGCTGCAGCAGAACACAAAGCTCGAGCTTTGTGTTCTGCTGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1234s21c1
Sequence:GTACCGGACAATCCAGAGTAACACTATTCTCGAGAATAGTGTTACTCTGGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1951s1c1
Sequence:CCGGGTTCGTGACATTCGGAGCTACCTCGAGGTAGCTCCGAATGTCACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1466s1c1
Sequence:CCGGCCATTGACGCCATCATCTTTGCTCGAGCAAAGATGATGGCGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004563.1-530s1c1
Sequence:CCGGGCACCATGTATGTGCTTCCATCTCGAGATGGAAGCACATACATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1876s1c1
Sequence:CCGGGAACAGGAGGTTCGTGACATTCTCGAGAATGTCACGAACCTCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-379s1c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1318s1c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1161s1c1
Sequence:CCGGCATGGCTACAATCCAGAGTAACTCGAGTTACTCTGGATTGTAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004563
VALIDATED
PCK2 MISSION shRNA shRNA Plasmid DNA
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-252s21c1
Sequence:GTACCGGTCCCACTGGCATTCGAGATTTCTCGAGAAATCTCGAATGCCAGTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-445s21c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-2065s21c1
Sequence:CCGGCTAGTCTAGCAAGAGGACATACTCGAGTATGTCCTCTTGCTAGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-684s21c1
Sequence:CCGGGGTGGCAAGCATGCGTATTATCTCGAGATAATACGCATGCTTGCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-1384s21c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1580s21c1
Sequence:CCGGCTGCTGCAGCAGAACACAAAGCTCGAGCTTTGTGTTCTGCTGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1234s21c1
Sequence:GTACCGGACAATCCAGAGTAACACTATTCTCGAGAATAGTGTTACTCTGGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1951s1c1
Sequence:CCGGGTTCGTGACATTCGGAGCTACCTCGAGGTAGCTCCGAATGTCACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1466s1c1
Sequence:CCGGCCATTGACGCCATCATCTTTGCTCGAGCAAAGATGATGGCGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004563.1-530s1c1
Sequence:CCGGGCACCATGTATGTGCTTCCATCTCGAGATGGAAGCACATACATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1876s1c1
Sequence:CCGGGAACAGGAGGTTCGTGACATTCTCGAGAATGTCACGAACCTCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-379s1c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1318s1c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1161s1c1
Sequence:CCGGCATGGCTACAATCCAGAGTAACTCGAGTTACTCTGGATTGTAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004563
VALIDATED
PCK2 MISSION shRNA Lentiviral Transduction Particles
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-252s21c1
Sequence:GTACCGGTCCCACTGGCATTCGAGATTTCTCGAGAAATCTCGAATGCCAGTGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-445s21c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-2065s21c1
Sequence:CCGGCTAGTCTAGCAAGAGGACATACTCGAGTATGTCCTCTTGCTAGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-684s21c1
Sequence:CCGGGGTGGCAAGCATGCGTATTATCTCGAGATAATACGCATGCTTGCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004563.2-1384s21c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1580s21c1
Sequence:CCGGCTGCTGCAGCAGAACACAAAGCTCGAGCTTTGTGTTCTGCTGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004563.2-1234s21c1
Sequence:GTACCGGACAATCCAGAGTAACACTATTCTCGAGAATAGTGTTACTCTGGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1951s1c1
Sequence:CCGGGTTCGTGACATTCGGAGCTACCTCGAGGTAGCTCCGAATGTCACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004563.2-1466s1c1
Sequence:CCGGCCATTGACGCCATCATCTTTGCTCGAGCAAAGATGATGGCGTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004563.1-530s1c1
Sequence:CCGGGCACCATGTATGTGCTTCCATCTCGAGATGGAAGCACATACATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1876s1c1
Sequence:CCGGGAACAGGAGGTTCGTGACATTCTCGAGAATGTCACGAACCTCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-379s1c1
Sequence:CCGGGTAGAGAGCAAGACGGTGATTCTCGAGAATCACCGTCTTGCTCTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1318s1c1
Sequence:CCGGGCACATCCCAACTCTCGATTTCTCGAGAAATCGAGAGTTGGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004563.1-1161s1c1
Sequence:CCGGCATGGCTACAATCCAGAGTAACTCGAGTTACTCTGGATTGTAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028994
VALIDATED
PCK2 MISSION shRNA Bacterial Glycerol Stock
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1885s21c1
Sequence:CCGGGACTGGATCTGCCGAAGATTACTCGAGTAATCTTCGGCAGATCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028994.2-542s21c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1471s21c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028994.2-2580s21c1
Sequence:CCGGTCTGTGTTTGAGTTAGTATTTCTCGAGAAATACTAACTCAAACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1798s21c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-771s21c1
Sequence:CCGGGGTGGCCAGTATGCGTATTATCTCGAGATAATACGCATACTGGCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028994.1-2579s1c1
Sequence:CCGGGCTCTGTGTTTGAGTTAGTATCTCGAGATACTAACTCAAACACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1799s1c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1553s1c1
Sequence:CCGGCCTATTGATGCCATCATCTTTCTCGAGAAAGATGATGGCATCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-543s1c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1472s1c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028994
VALIDATED
PCK2 MISSION shRNA shRNA Plasmid DNA
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1885s21c1
Sequence:CCGGGACTGGATCTGCCGAAGATTACTCGAGTAATCTTCGGCAGATCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028994.2-542s21c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1471s21c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028994.2-2580s21c1
Sequence:CCGGTCTGTGTTTGAGTTAGTATTTCTCGAGAAATACTAACTCAAACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1798s21c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-771s21c1
Sequence:CCGGGGTGGCCAGTATGCGTATTATCTCGAGATAATACGCATACTGGCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028994.1-2579s1c1
Sequence:CCGGGCTCTGTGTTTGAGTTAGTATCTCGAGATACTAACTCAAACACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1799s1c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1553s1c1
Sequence:CCGGCCTATTGATGCCATCATCTTTCTCGAGAAAGATGATGGCATCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-543s1c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1472s1c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028994
VALIDATED
PCK2 MISSION shRNA Lentiviral Transduction Particles
phosphoenolpyruvate carboxykinase 2 (mitochondrial)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1885s21c1
Sequence:CCGGGACTGGATCTGCCGAAGATTACTCGAGTAATCTTCGGCAGATCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028994.2-542s21c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1471s21c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028994.2-2580s21c1
Sequence:CCGGTCTGTGTTTGAGTTAGTATTTCTCGAGAAATACTAACTCAAACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-1798s21c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028994.2-771s21c1
Sequence:CCGGGGTGGCCAGTATGCGTATTATCTCGAGATAATACGCATACTGGCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028994.1-2579s1c1
Sequence:CCGGGCTCTGTGTTTGAGTTAGTATCTCGAGATACTAACTCAAACACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1799s1c1
Sequence:CCGGCCTCGTATCTTCCATGTCAATCTCGAGATTGACATGGAAGATACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1553s1c1
Sequence:CCGGCCTATTGATGCCATCATCTTTCTCGAGAAAGATGATGGCATCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-543s1c1
Sequence:CCGGAGACGGTGATTGTAACTCCTTCTCGAGAAGGAGTTACAATCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028994.1-1472s1c1
Sequence:CCGGGCACATCCAAACTCGCGCTTTCTCGAGAAAGCGCGAGTTTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)