EMAIL THIS PAGE TO A FRIEND

PCM1

pericentriolar material 1

106 Gene Product Result for
Synonyms: PTC4
UniProtKB ID: Q15154, Q58F13, Q6P1K7, Q8NB85, Q9BWC1, Q9H4A2
Gene ID:
Human(5108) Summary: The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. [provided by RefSeq, Sep 2010]
Mouse(18536) pericentriolar material 1
Rat(81740) pericentriolar material 1
Zebrafish(321709) pericentriolar material 1
Horse(100050372) pericentriolar material 1
domestic cat(101082487) pericentriolar material 1
dog(475618) pericentriolar material 1
chicken(395204) pericentriolar material 1
Domestic Rabbit(100345998) pericentriolar material 1
naked mole-rat(101725686) pericentriolar material 1
domestic guinea pig(100735275) pericentriolar material 1
cow(525337) pericentriolar material 1
sheep(101118162) pericentriolar material 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006197 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006197 Rosetta Predictions human pricing
XM_001057686 Rosetta Predictions rat pricing
XM_001057919 Rosetta Predictions rat pricing
XM_001057980 Rosetta Predictions rat pricing
XM_344524 Rosetta Predictions rat pricing
NM_023662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097348 predicted 603
2 SASI_Hs02_00341087 predicted 1643
3 SASI_Hs02_00341088 predicted 5870
4 SASI_Hs01_00097351 predicted 2048
5 SASI_Hs01_00097352 predicted 4662
6 SASI_Hs01_00097353 predicted 2901
7 SASI_Hs01_00097354 predicted 4655
8 SASI_Hs01_00097355 predicted 1033
9 SASI_Hs01_00097356 predicted 4748
10 SASI_Hs02_00341089 predicted 1159
11 SASI_Hs01_00097349 predicted 3658
12 SASI_Hs01_00097350 predicted 3461
13 SASI_Hs01_00097357 predicted 4568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287199 predicted 605
2 SASI_Rn02_00287200 predicted 3910
3 SASI_Rn02_00287201 predicted 522
4 SASI_Rn02_00287202 predicted 535
5 SASI_Rn02_00287203 predicted 3414
6 SASI_Rn02_00287204 predicted 2695
7 SASI_Rn02_00287205 predicted 1189
8 SASI_Rn02_00287206 predicted 5081
9 SASI_Rn02_00287207 predicted 2532
10 SASI_Rn02_00287208 predicted 2885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287973 predicted 607
2 SASI_Rn02_00287974 predicted 4026
3 SASI_Rn02_00287975 predicted 520
4 SASI_Rn02_00287976 predicted 528
5 SASI_Rn02_00287977 predicted 1024
6 SASI_Rn02_00287978 predicted 2807
7 SASI_Rn02_00287979 predicted 1303
8 SASI_Rn02_00287980 predicted 5197
9 SASI_Rn02_00287981 predicted 2647
10 SASI_Rn02_00287982 predicted 3001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288146 predicted 609
2 SASI_Rn02_00288147 predicted 3914
3 SASI_Rn02_00288148 predicted 521
4 SASI_Rn02_00288149 predicted 531
5 SASI_Rn02_00288150 predicted 3416
6 SASI_Rn02_00288151 predicted 2693
7 SASI_Rn02_00288152 predicted 1188
8 SASI_Rn02_00288153 predicted 5086
9 SASI_Rn02_00288154 predicted 2533
10 SASI_Rn02_00288155 predicted 2884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397220 predicted 609
2 SASI_Rn02_00397221 predicted 4024
3 SASI_Rn02_00397222 predicted 523
4 SASI_Rn02_00397223 predicted 529
5 SASI_Rn02_00397224 predicted 1016
6 SASI_Rn02_00397225 predicted 2813
7 SASI_Rn02_00397226 predicted 1303
8 SASI_Rn02_00397227 predicted 5196
9 SASI_Rn02_00397228 predicted 2651
10 SASI_Rn02_00397229 predicted 3001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100264 predicted 4357
2 SASI_Mm01_00100265 predicted 519
3 SASI_Mm02_00327277 predicted 4719
4 SASI_Mm01_00100266 predicted 5219
5 SASI_Mm01_00100269 predicted 2026
6 SASI_Mm01_00100270 predicted 3992
7 SASI_Mm01_00100271 predicted 4783
8 SASI_Mm01_00100272 predicted 931
9 SASI_Mm02_00327278 predicted 5090
10 SASI_Mm02_00327279 predicted 4761
11 SASI_Mm01_00100267 predicted 4990
12 SASI_Mm01_00100268 predicted 5878
13 SASI_Mm01_00100273 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006197
VALIDATED
PCM1 MISSION shRNA Bacterial Glycerol Stock
pericentriolar material 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-604s1c1
Sequence:CCGGGCGGATAAACTTCAGTGATTTCTCGAGAAATCACTGAAGTTTATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-6372s1c1
Sequence:CCGGGCTCATCTAACTCTGTCCTTACTCGAGTAAGGACAGAGTTAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006197.2-605s1c1
Sequence:CCGGCGGATAAACTTCAGTGATTTACTCGAGTAAATCACTGAAGTTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-4559s21c1
Sequence:CCGGAGCTTTGCGAGATACTATTTACTCGAGTAAATAGTATCTCGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-3953s1c1
Sequence:CCGGCCATTTATCAAGACTGGATTTCTCGAGAAATCCAGTCTTGATAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-5043s21c1
Sequence:CCGGAGATGCACCTGCAGGATTATTCTCGAGAATAATCCTGCAGGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-4519s1c1
Sequence:CCGGGCAGCTACTAAACACAGACTACTCGAGTAGTCTGTGTTTAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-4040s21c1
Sequence:CCGGCAGTAGGACACCATGGTTATACTCGAGTATAACCATGGTGTCCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006197.3-6749s21c1
Sequence:CCGGTGATGTTTGGTAACGAATTTACTCGAGTAAATTCGTTACCAAACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-1048s21c1
Sequence:CCGGTTGTTCAAATTCGCGATTATACTCGAGTATAATCGCGAATTTGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006197
VALIDATED
PCM1 MISSION shRNA shRNA Plasmid DNA
pericentriolar material 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-604s1c1
Sequence:CCGGGCGGATAAACTTCAGTGATTTCTCGAGAAATCACTGAAGTTTATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-6372s1c1
Sequence:CCGGGCTCATCTAACTCTGTCCTTACTCGAGTAAGGACAGAGTTAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006197.2-605s1c1
Sequence:CCGGCGGATAAACTTCAGTGATTTACTCGAGTAAATCACTGAAGTTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-4559s21c1
Sequence:CCGGAGCTTTGCGAGATACTATTTACTCGAGTAAATAGTATCTCGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-3953s1c1
Sequence:CCGGCCATTTATCAAGACTGGATTTCTCGAGAAATCCAGTCTTGATAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-5043s21c1
Sequence:CCGGAGATGCACCTGCAGGATTATTCTCGAGAATAATCCTGCAGGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-4519s1c1
Sequence:CCGGGCAGCTACTAAACACAGACTACTCGAGTAGTCTGTGTTTAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-4040s21c1
Sequence:CCGGCAGTAGGACACCATGGTTATACTCGAGTATAACCATGGTGTCCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006197.3-6749s21c1
Sequence:CCGGTGATGTTTGGTAACGAATTTACTCGAGTAAATTCGTTACCAAACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-1048s21c1
Sequence:CCGGTTGTTCAAATTCGCGATTATACTCGAGTATAATCGCGAATTTGAACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006197
VALIDATED
PCM1 MISSION shRNA Lentiviral Transduction Particles
pericentriolar material 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-604s1c1
Sequence:CCGGGCGGATAAACTTCAGTGATTTCTCGAGAAATCACTGAAGTTTATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-6372s1c1
Sequence:CCGGGCTCATCTAACTCTGTCCTTACTCGAGTAAGGACAGAGTTAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006197.2-605s1c1
Sequence:CCGGCGGATAAACTTCAGTGATTTACTCGAGTAAATCACTGAAGTTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-4559s21c1
Sequence:CCGGAGCTTTGCGAGATACTATTTACTCGAGTAAATAGTATCTCGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-3953s1c1
Sequence:CCGGCCATTTATCAAGACTGGATTTCTCGAGAAATCCAGTCTTGATAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-5043s21c1
Sequence:CCGGAGATGCACCTGCAGGATTATTCTCGAGAATAATCCTGCAGGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006197.2-4519s1c1
Sequence:CCGGGCAGCTACTAAACACAGACTACTCGAGTAGTCTGTGTTTAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006197.3-4040s21c1
Sequence:CCGGCAGTAGGACACCATGGTTATACTCGAGTATAACCATGGTGTCCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006197.3-6749s21c1
Sequence:CCGGTGATGTTTGGTAACGAATTTACTCGAGTAAATTCGTTACCAAACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006197.3-1048s21c1
Sequence:CCGGTTGTTCAAATTCGCGATTATACTCGAGTATAATCGCGAATTTGAACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023662
VALIDATED
PCM1 MISSION shRNA Bacterial Glycerol Stock
pericentriolar material 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6127s1c1
Sequence:CCGGCGCTCAAACTGACAGTCTATTCTCGAGAATAGACTGTCAGTTTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6304s1c1
Sequence:CCGGGAGACTCATCTAACTCTCTTACTCGAGTAAGAGAGTTAGATGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-398s21c1
Sequence:CCGGGAGGGTAACTAACGCTATTTCCTCGAGGAAATAGCGTTAGTTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-3526s21c1
Sequence:CCGGACCCTTCTTCTCCCAATTTATCTCGAGATAAATTGGGAGAAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-1132s21c1
Sequence:CCGGTTCTAGCTTTGCAGCATAAAGCTCGAGCTTTATGCTGCAAAGCTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-858s21c1
Sequence:CCGGATCCGTGACTATATTACTAAACTCGAGTTTAGTAATATAGTCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-438s1c1
Sequence:CCGGCGAAGAACAAAGATTCCACATCTCGAGATGTGGAATCTTTGTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023662.1-3173s1c1
Sequence:CCGGGCTCTCTTACATAGAAGAGAACTCGAGTTCTCTTCTATGTAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-4436s1c1
Sequence:CCGGGCAGCTACTTAATACAGACTACTCGAGTAGTCTGTATTAAGTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-2035s21c1
Sequence:CCGGCATTAGACTGTCGATACAATACTCGAGTATTGTATCGACAGTCTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-527s21c1
Sequence:CCGGGAAACTTAAACAGCGGATAAACTCGAGTTTATCCGCTGTTTAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023662
VALIDATED
PCM1 MISSION shRNA shRNA Plasmid DNA
pericentriolar material 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6127s1c1
Sequence:CCGGCGCTCAAACTGACAGTCTATTCTCGAGAATAGACTGTCAGTTTGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6304s1c1
Sequence:CCGGGAGACTCATCTAACTCTCTTACTCGAGTAAGAGAGTTAGATGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-398s21c1
Sequence:CCGGGAGGGTAACTAACGCTATTTCCTCGAGGAAATAGCGTTAGTTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-3526s21c1
Sequence:CCGGACCCTTCTTCTCCCAATTTATCTCGAGATAAATTGGGAGAAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-1132s21c1
Sequence:CCGGTTCTAGCTTTGCAGCATAAAGCTCGAGCTTTATGCTGCAAAGCTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-858s21c1
Sequence:CCGGATCCGTGACTATATTACTAAACTCGAGTTTAGTAATATAGTCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-438s1c1
Sequence:CCGGCGAAGAACAAAGATTCCACATCTCGAGATGTGGAATCTTTGTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023662.1-3173s1c1
Sequence:CCGGGCTCTCTTACATAGAAGAGAACTCGAGTTCTCTTCTATGTAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-4436s1c1
Sequence:CCGGGCAGCTACTTAATACAGACTACTCGAGTAGTCTGTATTAAGTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-2035s21c1
Sequence:CCGGCATTAGACTGTCGATACAATACTCGAGTATTGTATCGACAGTCTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-527s21c1
Sequence:CCGGGAAACTTAAACAGCGGATAAACTCGAGTTTATCCGCTGTTTAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023662
VALIDATED
PCM1 MISSION shRNA Lentiviral Transduction Particles
pericentriolar material 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6127s1c1
Sequence:CCGGCGCTCAAACTGACAGTCTATTCTCGAGAATAGACTGTCAGTTTGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-6304s1c1
Sequence:CCGGGAGACTCATCTAACTCTCTTACTCGAGTAAGAGAGTTAGATGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-398s21c1
Sequence:CCGGGAGGGTAACTAACGCTATTTCCTCGAGGAAATAGCGTTAGTTACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-3526s21c1
Sequence:CCGGACCCTTCTTCTCCCAATTTATCTCGAGATAAATTGGGAGAAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-1132s21c1
Sequence:CCGGTTCTAGCTTTGCAGCATAAAGCTCGAGCTTTATGCTGCAAAGCTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023662.3-858s21c1
Sequence:CCGGATCCGTGACTATATTACTAAACTCGAGTTTAGTAATATAGTCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-438s1c1
Sequence:CCGGCGAAGAACAAAGATTCCACATCTCGAGATGTGGAATCTTTGTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023662.1-3173s1c1
Sequence:CCGGGCTCTCTTACATAGAAGAGAACTCGAGTTCTCTTCTATGTAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023662.1-4436s1c1
Sequence:CCGGGCAGCTACTTAATACAGACTACTCGAGTAGTCTGTATTAAGTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-2035s21c1
Sequence:CCGGCATTAGACTGTCGATACAATACTCGAGTATTGTATCGACAGTCTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_023662.3-527s21c1
Sequence:CCGGGAAACTTAAACAGCGGATAAACTCGAGTTTATCCGCTGTTTAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)