EMAIL THIS PAGE TO A FRIEND

PCMT1

protein-L-isoaspartate (D-aspartate) O-methyltransferase

124 Gene Product Result for
Synonyms: PIMT
Gene ID:
Human(5110) Summary: This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(18537) protein-L-isoaspartate (D-aspartate) O-methyltransferase 1
Rat(25604) protein-L-isoaspartate (D-aspartate) O-methyltransferase 1
chicken(428607) protein-L-isoaspartate (D-aspartate) O-methyltransferase
domestic cat(101081732) protein-L-isoaspartate (D-aspartate) O-methyltransferase
dog(476242) protein-L-isoaspartate (D-aspartate) O-methyltransferase
cow(613854) protein-L-isoaspartate (D-aspartate) O-methyltransferase
sheep(101104502) protein-L-isoaspartate (D-aspartate) O-methyltransferase
domestic guinea pig(100731541) protein-L-isoaspartate (D-aspartate) O-methyltransferase
naked mole-rat(101723169) protein-L-isoaspartate (D-aspartate) O-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005389 Rosetta Predictions human pricing
NM_013073 Rosetta Predictions rat pricing
NM_008786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229688 predicted 1001
2 SASI_Hs01_00229689 predicted 383
3 SASI_Hs02_00339511 predicted 703
4 SASI_Hs01_00229691 predicted 200
5 SASI_Hs01_00229692 predicted 410
6 SASI_Hs01_00229694 predicted 898
7 SASI_Hs01_00229695 predicted 568
8 SASI_Hs02_00339512 predicted 427
9 SASI_Hs02_00339513 predicted 961
10 SASI_Hs02_00339514 predicted 584
11 SASI_Hs01_00229690 predicted 525
12 SASI_Hs01_00229693 predicted 583
13 SASI_Hs01_00229696 predicted 314
14 SASI_Hs01_00229697 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049597 predicted 688
2 SASI_Rn01_00049598 predicted 449
3 SASI_Rn02_00260826 predicted 668
4 SASI_Rn01_00049599 predicted 602
5 SASI_Rn02_00260827 predicted 417
6 SASI_Rn01_00049600 predicted 237
7 SASI_Rn01_00049601 predicted 441
8 SASI_Rn01_00049602 predicted 237
9 SASI_Rn01_00049603 predicted 256
10 SASI_Rn01_00049604 predicted 869
11 SASI_Rn01_00049596 predicted 426
12 SASI_Rn01_00049605 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153190 predicted 899
2 SASI_Mm01_00153191 predicted 244
3 SASI_Mm01_00153192 predicted 459
4 SASI_Mm02_00314685 predicted 676
5 SASI_Mm01_00153193 predicted 304
6 SASI_Mm01_00153194 predicted 618
7 SASI_Mm01_00153195 predicted 458
8 SASI_Mm01_00153196 predicted 468
9 SASI_Mm01_00153197 predicted 823
10 SASI_Mm01_00153198 predicted 315
11 SASI_Mm01_00153189 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008786
VALIDATED
PCMT1 MISSION shRNA Bacterial Glycerol Stock
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008786.1-860s1c1
Sequence:CCGGCGTGAGCTTGACCAGTCTATACTCGAGTATAGACTGGTCAAGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-252s1c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-696s1c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-167s1c1
Sequence:CCGGCCTCCGCAAGAATGGAATCATCTCGAGATGATTCCATTCTTGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-641s1c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1091s21c1
Sequence:CCGGATACGTGCCTTTAACAGATAACTCGAGTTATCTGTTAAAGGCACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1032s21c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-588s21c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1410s21c1
Sequence:CCGGACATGCCCACATTTCACTTTACTCGAGTAAAGTGAAATGTGGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-977s21c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008786
VALIDATED
PCMT1 MISSION shRNA shRNA Plasmid DNA
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008786.1-860s1c1
Sequence:CCGGCGTGAGCTTGACCAGTCTATACTCGAGTATAGACTGGTCAAGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-252s1c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-696s1c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-167s1c1
Sequence:CCGGCCTCCGCAAGAATGGAATCATCTCGAGATGATTCCATTCTTGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-641s1c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1091s21c1
Sequence:CCGGATACGTGCCTTTAACAGATAACTCGAGTTATCTGTTAAAGGCACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1032s21c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-588s21c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1410s21c1
Sequence:CCGGACATGCCCACATTTCACTTTACTCGAGTAAAGTGAAATGTGGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-977s21c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008786
VALIDATED
PCMT1 MISSION shRNA Lentiviral Transduction Particles
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008786.1-860s1c1
Sequence:CCGGCGTGAGCTTGACCAGTCTATACTCGAGTATAGACTGGTCAAGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-252s1c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-696s1c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-167s1c1
Sequence:CCGGCCTCCGCAAGAATGGAATCATCTCGAGATGATTCCATTCTTGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008786.1-641s1c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1091s21c1
Sequence:CCGGATACGTGCCTTTAACAGATAACTCGAGTTATCTGTTAAAGGCACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1032s21c1
Sequence:CCGGGAGCAGTATGACAAGCTACAACTCGAGTTGTAGCTTGTCATACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-588s21c1
Sequence:CCGGCCTTACATGGATTCTCCACAACTCGAGTTGTGGAGAATCCATGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-1410s21c1
Sequence:CCGGACATGCCCACATTTCACTTTACTCGAGTAAAGTGAAATGTGGGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008786.2-977s21c1
Sequence:CCGGGCCTGGTGGAAGATTGATATTCTCGAGAATATCAATCTTCCACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005389
VALIDATED
PCMT1 MISSION shRNA Bacterial Glycerol Stock
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-571s1c1
Sequence:CCGGCCAGGCGCTAATAGATCAGTTCTCGAGAACTGATCTATTAGCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-653s1c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005389.1-221s1c1
Sequence:CCGGCCACAATCAATAGGTTTCCAACTCGAGTTGGAAACCTATTGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-401s1c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-275s1c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005389.2-787s21c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-409s21c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-948s21c1
Sequence:CCGGCATCAGCTTGACCAGTATAAACTCGAGTTTATACTGGTCAAGCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-535s21c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-728s21c1
Sequence:CCGGAGCCCGGAGGAAGATTGATATCTCGAGATATCAATCTTCCTCCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005389
VALIDATED
PCMT1 MISSION shRNA shRNA Plasmid DNA
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-571s1c1
Sequence:CCGGCCAGGCGCTAATAGATCAGTTCTCGAGAACTGATCTATTAGCGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-653s1c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005389.1-221s1c1
Sequence:CCGGCCACAATCAATAGGTTTCCAACTCGAGTTGGAAACCTATTGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-401s1c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-275s1c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005389.2-787s21c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-409s21c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-948s21c1
Sequence:CCGGCATCAGCTTGACCAGTATAAACTCGAGTTTATACTGGTCAAGCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-535s21c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-728s21c1
Sequence:CCGGAGCCCGGAGGAAGATTGATATCTCGAGATATCAATCTTCCTCCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005389
VALIDATED
PCMT1 MISSION shRNA Lentiviral Transduction Particles
protein-L-isoaspartate (D-aspartate) O-methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-571s1c1
Sequence:CCGGCCAGGCGCTAATAGATCAGTTCTCGAGAACTGATCTATTAGCGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-653s1c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005389.1-221s1c1
Sequence:CCGGCCACAATCAATAGGTTTCCAACTCGAGTTGGAAACCTATTGATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-401s1c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005389.1-275s1c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005389.2-787s21c1
Sequence:CCGGCAGTATGACAAGCTACAAGATCTCGAGATCTTGTAGCTTGTCATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-409s21c1
Sequence:CCGGGCGCTAGAACTTCTATTTGATCTCGAGATCAAATAGAAGTTCTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-948s21c1
Sequence:CCGGCATCAGCTTGACCAGTATAAACTCGAGTTTATACTGGTCAAGCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-535s21c1
Sequence:CCGGGATCACATTAAAGAGCTAGTACTCGAGTACTAGCTCTTTAATGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005389.2-728s21c1
Sequence:CCGGAGCCCGGAGGAAGATTGATATCTCGAGATATCAATCTTCCTCCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)