EMAIL THIS PAGE TO A FRIEND

PCMTD1

protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1

146 Gene Product Result for
UniProtKB ID: Q96MG8, Q96FK9
Gene ID:
Mouse(319263) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Rat(366300) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
naked mole-rat(101715288) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
domestic guinea pig(100723996) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
cow(521261) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
sheep(101112825) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Zebrafish(327176) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Horse(100050193) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
domestic cat(101091754) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
dog(477874) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
chicken(421114) protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052937 Rosetta Predictions human pricing
XR_005972 Rosetta Predictions rat pricing
XR_009564 Rosetta Predictions rat pricing
NM_183028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125854 predicted 955
2 SASI_Hs01_00125855 predicted 661
3 SASI_Hs01_00125856 predicted 758
4 SASI_Hs01_00125857 predicted 564
5 SASI_Hs01_00125859 predicted 940
6 SASI_Hs01_00125860 predicted 549
7 SASI_Hs01_00125861 predicted 306
8 SASI_Hs01_00125862 predicted 542
9 SASI_Hs01_00125863 predicted 643
10 SASI_Hs02_00361722 predicted 744
11 SASI_Hs01_00125858 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173547 predicted 2577
2 SASI_Rn02_00410692 predicted 2915
3 SASI_Rn01_00173548 predicted 1794
4 SASI_Rn01_00173549 predicted 3598
5 SASI_Rn01_00173550 predicted 2279
6 SASI_Rn01_00173551 predicted 2625
7 SASI_Rn02_00410693 predicted 2494
8 SASI_Rn01_00173554 predicted 1565
9 SASI_Rn01_00173555 predicted 2842
10 SASI_Rn01_00173556 predicted 2553
11 SASI_Rn01_00173552 predicted 2660
12 SASI_Rn01_00173553 predicted 3743
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191397 predicted 708
2 SASI_Rn01_00191398 predicted 598
3 SASI_Rn01_00191399 predicted 694
4 SASI_Rn01_00191401 predicted 763
5 SASI_Rn01_00191402 predicted 695
6 SASI_Rn01_00191403 predicted 623
7 SASI_Rn01_00191404 predicted 308
8 SASI_Rn01_00191405 predicted 355
9 SASI_Rn01_00191400 predicted 680
10 SASI_Rn02_00420167 predicted 26
11 SASI_Rn01_00191406 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350028 predicted 1253
2 SASI_Mm01_00115955 predicted 1522
3 SASI_Mm01_00115956 predicted 1486
4 SASI_Mm01_00115957 predicted 733
5 SASI_Mm01_00115959 predicted 514
6 SASI_Mm02_00350029 predicted 446
7 SASI_Mm01_00115963 predicted 838
8 SASI_Mm01_00115964 predicted 1541
9 SASI_Mm02_00350030 predicted 1064
10 SASI_Mm02_00350031 predicted 615
11 SASI_Mm01_00115958 predicted 1008
12 SASI_Mm01_00115960 predicted 889
13 SASI_Mm01_00115961 predicted 1270
14 SASI_Mm01_00115962 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183028
PCMTD1 MISSION shRNA Bacterial Glycerol Stock
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-883s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-1141s21c1
Sequence:CCGGCCAAGACTTGGCTCGCATTTACTCGAGTAAATGCGAGCCAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183028.3-4465s21c1
Sequence:CCGGCATCGAGACACCGGACTTAAACTCGAGTTTAAGTCCGGTGTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.3-882s1c1
Sequence:CCGGGTCATCAGTATGATCGAATTTCTCGAGAAATTCGATCATACTGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-696s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-202s1c1
Sequence:CCGGCGAACTGAAAGAGTAGAGCAACTCGAGTTGCTCTACTCTTTCAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-190s1c1
Sequence:CCGGGCTCAGTACATCCGAACTGAACTCGAGTTCAGTTCGGATGTACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183028
PCMTD1 MISSION shRNA shRNA Plasmid DNA
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-883s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-1141s21c1
Sequence:CCGGCCAAGACTTGGCTCGCATTTACTCGAGTAAATGCGAGCCAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183028.3-4465s21c1
Sequence:CCGGCATCGAGACACCGGACTTAAACTCGAGTTTAAGTCCGGTGTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.3-882s1c1
Sequence:CCGGGTCATCAGTATGATCGAATTTCTCGAGAAATTCGATCATACTGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-696s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-202s1c1
Sequence:CCGGCGAACTGAAAGAGTAGAGCAACTCGAGTTGCTCTACTCTTTCAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-190s1c1
Sequence:CCGGGCTCAGTACATCCGAACTGAACTCGAGTTCAGTTCGGATGTACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183028
PCMTD1 MISSION shRNA Lentiviral Transduction Particles
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-883s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-1141s21c1
Sequence:CCGGCCAAGACTTGGCTCGCATTTACTCGAGTAAATGCGAGCCAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183028.3-4465s21c1
Sequence:CCGGCATCGAGACACCGGACTTAAACTCGAGTTTAAGTCCGGTGTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.3-882s1c1
Sequence:CCGGGTCATCAGTATGATCGAATTTCTCGAGAAATTCGATCATACTGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183028.3-696s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-202s1c1
Sequence:CCGGCGAACTGAAAGAGTAGAGCAACTCGAGTTGCTCTACTCTTTCAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183028.1-190s1c1
Sequence:CCGGGCTCAGTACATCCGAACTGAACTCGAGTTCAGTTCGGATGTACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052937
VALIDATED
PCMTD1 MISSION shRNA Bacterial Glycerol Stock
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-812s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-449s21c1
Sequence:CCGGTGATCGTGGAGATTACTATTTCTCGAGAAATAGTAATCTCCACGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-603s21c1
Sequence:CCGGGGAAGTGGAACCGGATATTTACTCGAGTAAATATCCGGTTCCACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-625s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-907s21c1
Sequence:CCGGTGCCTATAGAGGATCAGTTAACTCGAGTTAACTGATCCTCTATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-824s1c1
Sequence:CCGGCTACAGGACTTGGCTCGTATTCTCGAGAATACGAGCCAAGTCCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-3624s1c1
Sequence:CCGGCCTGAAACATACAGTGAGTTACTCGAGTAACTCACTGTATGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052937.1-320s1c1
Sequence:CCGGGCATTGAAACTTCAACCAGGACTCGAGTCCTGGTTGAAGTTTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052937.1-2697s1c1
Sequence:CCGGGCTCCAGTAATTCCACAACATCTCGAGATGTTGTGGAATTACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-704s1c1
Sequence:CCGGCAGAACACTTGGGAAAGTAAACTCGAGTTTACTTTCCCAAGTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052937.1-648s1c1
Sequence:CCGGGAGGCATATTAGTCATGCCTACTCGAGTAGGCATGACTAATATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-596s1c1
Sequence:CCGGGCTGGAGTACAGAAAGACCATCTCGAGATGGTCTTTCTGTACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052937
VALIDATED
PCMTD1 MISSION shRNA shRNA Plasmid DNA
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-812s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-449s21c1
Sequence:CCGGTGATCGTGGAGATTACTATTTCTCGAGAAATAGTAATCTCCACGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-603s21c1
Sequence:CCGGGGAAGTGGAACCGGATATTTACTCGAGTAAATATCCGGTTCCACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-625s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-907s21c1
Sequence:CCGGTGCCTATAGAGGATCAGTTAACTCGAGTTAACTGATCCTCTATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-824s1c1
Sequence:CCGGCTACAGGACTTGGCTCGTATTCTCGAGAATACGAGCCAAGTCCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-3624s1c1
Sequence:CCGGCCTGAAACATACAGTGAGTTACTCGAGTAACTCACTGTATGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052937.1-320s1c1
Sequence:CCGGGCATTGAAACTTCAACCAGGACTCGAGTCCTGGTTGAAGTTTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052937.1-2697s1c1
Sequence:CCGGGCTCCAGTAATTCCACAACATCTCGAGATGTTGTGGAATTACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-704s1c1
Sequence:CCGGCAGAACACTTGGGAAAGTAAACTCGAGTTTACTTTCCCAAGTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052937.1-648s1c1
Sequence:CCGGGAGGCATATTAGTCATGCCTACTCGAGTAGGCATGACTAATATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-596s1c1
Sequence:CCGGGCTGGAGTACAGAAAGACCATCTCGAGATGGTCTTTCTGTACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052937
VALIDATED
PCMTD1 MISSION shRNA Lentiviral Transduction Particles
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-812s21c1
Sequence:CCGGTCATCAGTATGATCGAATTTACTCGAGTAAATTCGATCATACTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-449s21c1
Sequence:CCGGTGATCGTGGAGATTACTATTTCTCGAGAAATAGTAATCTCCACGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-603s21c1
Sequence:CCGGGGAAGTGGAACCGGATATTTACTCGAGTAAATATCCGGTTCCACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-625s21c1
Sequence:CCGGGTACAATGGTGGGCTTAATTTCTCGAGAAATTAAGCCCACCATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_052937.2-907s21c1
Sequence:CCGGTGCCTATAGAGGATCAGTTAACTCGAGTTAACTGATCCTCTATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-824s1c1
Sequence:CCGGCTACAGGACTTGGCTCGTATTCTCGAGAATACGAGCCAAGTCCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-3624s1c1
Sequence:CCGGCCTGAAACATACAGTGAGTTACTCGAGTAACTCACTGTATGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052937.1-320s1c1
Sequence:CCGGGCATTGAAACTTCAACCAGGACTCGAGTCCTGGTTGAAGTTTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052937.1-2697s1c1
Sequence:CCGGGCTCCAGTAATTCCACAACATCTCGAGATGTTGTGGAATTACTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052937.1-704s1c1
Sequence:CCGGCAGAACACTTGGGAAAGTAAACTCGAGTTTACTTTCCCAAGTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052937.1-648s1c1
Sequence:CCGGGAGGCATATTAGTCATGCCTACTCGAGTAGGCATGACTAATATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_052937.1-596s1c1
Sequence:CCGGGCTGGAGTACAGAAAGACCATCTCGAGATGGTCTTTCTGTACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)