EMAIL THIS PAGE TO A FRIEND

PCNP

PEST proteolytic signal containing nuclear protein

162 Gene Product Result for
Gene ID:
Mouse(76302) PEST proteolytic signal containing nuclear protein
Rat(288165) PEST proteolytic signal containing nuclear protein
Zebrafish(450014) PEST proteolytic signal containing nuclear protein
chicken(418398) PEST proteolytic signal containing nuclear protein
domestic cat(101095039) PEST proteolytic signal containing nuclear protein
dog(478546) PEST proteolytic signal containing nuclear protein
cow(615197) PEST proteolytic signal containing nuclear protein
sheep(101109854) PEST proteolytic signal containing nuclear protein
domestic guinea pig(100734436) PEST proteolytic signal containing nuclear protein
naked mole-rat(101721054) PEST proteolytic signal containing nuclear protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020357 Rosetta Predictions human pricing
NM_001047846 Rosetta Predictions rat pricing
NM_001024622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072817 predicted 242
2 SASI_Hs01_00072818 predicted 238
3 SASI_Hs01_00072820 predicted 221
4 SASI_Hs01_00072822 predicted 262
5 SASI_Hs01_00072815 predicted 877
6 SASI_Hs01_00072823 predicted 198
7 SASI_Hs01_00072824 predicted 271
8 SASI_Hs02_00353293 predicted 280
9 SASI_Hs01_00072816 predicted 906
10 SASI_Hs02_00353294 predicted 306
11 SASI_Hs01_00072819 predicted 912
12 SASI_Hs01_00072821 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206135 predicted 241
2 SASI_Rn02_00206136 predicted 354
3 SASI_Rn02_00206137 predicted 252
4 SASI_Rn02_00206138 predicted 334
5 SASI_Rn02_00206139 predicted 311
6 SASI_Rn02_00206140 predicted 241
7 SASI_Rn02_00206141 predicted 222
8 SASI_Rn02_00206142 predicted 274
9 SASI_Rn02_00206143 predicted 315
10 SASI_Rn02_00206144 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181317 predicted 339
2 SASI_Mm01_00181318 predicted 367
3 SASI_Mm01_00181319 predicted 285
4 SASI_Mm01_00181320 predicted 1063
5 SASI_Mm01_00181322 predicted 253
6 SASI_Mm01_00181323 predicted 217
7 SASI_Mm01_00181324 predicted 196
8 SASI_Mm01_00181325 predicted 1037
9 SASI_Mm01_00181326 predicted 238
10 SASI_Mm02_00287636 predicted 963
11 SASI_Mm01_00181321 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020357
VALIDATED
PCNP MISSION shRNA Bacterial Glycerol Stock
PEST proteolytic signal containing nuclear protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-1982s1c1
Sequence:CCGGCCCAAGTAAGACAATGGAAATCTCGAGATTTCCATTGTCTTACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1927s1c1
Sequence:CCGGGCAGCCTGTGTATATTCCTAACTCGAGTTAGGAATATACACAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-239s1c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1307s1c1
Sequence:CCGGCCACCAGAACTTGAGGCAAATCTCGAGATTTGCCTCAAGTTCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-83s1c1
Sequence:CCGGGACCTGAAGAAGAAGCAGAAACTCGAGTTTCTGCTTCTTCTTCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-530s1c1
Sequence:CCGGGAAATGTCCATGACCAAGACACTCGAGTGTCTTGGTCATGGACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020357.1-255s1c1
Sequence:CCGGGACAAAGAAAGCATCAGCCATCTCGAGATGGCTGATGCTTTCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-239s21c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-536s21c1
Sequence:CCGGTCCATGACCAAGACAATTAAACTCGAGTTTAATTGTCTTGGTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-286s21c1
Sequence:CCGGCTTGGATCAAGTAAGCCTAAACTCGAGTTTAGGCTTACTTGATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-921s21c1
Sequence:CCGGTAACTCCCTTATTACCTAAACCTCGAGGTTTAGGTAATAAGGGAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-494s21c1
Sequence:CCGGAGAAGCTGTGGGAGCGAAATACTCGAGTATTTCGCTCCCACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020357
VALIDATED
PCNP MISSION shRNA shRNA Plasmid DNA
PEST proteolytic signal containing nuclear protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-1982s1c1
Sequence:CCGGCCCAAGTAAGACAATGGAAATCTCGAGATTTCCATTGTCTTACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1927s1c1
Sequence:CCGGGCAGCCTGTGTATATTCCTAACTCGAGTTAGGAATATACACAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-239s1c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1307s1c1
Sequence:CCGGCCACCAGAACTTGAGGCAAATCTCGAGATTTGCCTCAAGTTCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-83s1c1
Sequence:CCGGGACCTGAAGAAGAAGCAGAAACTCGAGTTTCTGCTTCTTCTTCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-530s1c1
Sequence:CCGGGAAATGTCCATGACCAAGACACTCGAGTGTCTTGGTCATGGACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020357.1-255s1c1
Sequence:CCGGGACAAAGAAAGCATCAGCCATCTCGAGATGGCTGATGCTTTCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-239s21c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-536s21c1
Sequence:CCGGTCCATGACCAAGACAATTAAACTCGAGTTTAATTGTCTTGGTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-286s21c1
Sequence:CCGGCTTGGATCAAGTAAGCCTAAACTCGAGTTTAGGCTTACTTGATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-921s21c1
Sequence:CCGGTAACTCCCTTATTACCTAAACCTCGAGGTTTAGGTAATAAGGGAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-494s21c1
Sequence:CCGGAGAAGCTGTGGGAGCGAAATACTCGAGTATTTCGCTCCCACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020357
VALIDATED
PCNP MISSION shRNA Lentiviral Transduction Particles
PEST proteolytic signal containing nuclear protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-1982s1c1
Sequence:CCGGCCCAAGTAAGACAATGGAAATCTCGAGATTTCCATTGTCTTACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1927s1c1
Sequence:CCGGGCAGCCTGTGTATATTCCTAACTCGAGTTAGGAATATACACAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020357.1-239s1c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020357.1-1307s1c1
Sequence:CCGGCCACCAGAACTTGAGGCAAATCTCGAGATTTGCCTCAAGTTCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-83s1c1
Sequence:CCGGGACCTGAAGAAGAAGCAGAAACTCGAGTTTCTGCTTCTTCTTCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020357.1-530s1c1
Sequence:CCGGGAAATGTCCATGACCAAGACACTCGAGTGTCTTGGTCATGGACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020357.1-255s1c1
Sequence:CCGGGACAAAGAAAGCATCAGCCATCTCGAGATGGCTGATGCTTTCTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-239s21c1
Sequence:CCGGCCATAGGTAGTCAGACGACAACTCGAGTTGTCGTCTGACTACCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-536s21c1
Sequence:CCGGTCCATGACCAAGACAATTAAACTCGAGTTTAATTGTCTTGGTCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-286s21c1
Sequence:CCGGCTTGGATCAAGTAAGCCTAAACTCGAGTTTAGGCTTACTTGATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020357.1-921s21c1
Sequence:CCGGTAACTCCCTTATTACCTAAACCTCGAGGTTTAGGTAATAAGGGAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020357.1-494s21c1
Sequence:CCGGAGAAGCTGTGGGAGCGAAATACTCGAGTATTTCGCTCCCACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024622
PCNP MISSION shRNA Bacterial Glycerol Stock
PEST proteolytic signal containing nuclear protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-528s21c1
Sequence:CCGGGAAGCTGTGGGAGCGAAATATCTCGAGATATTTCGCTCCCACAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024622.2-1964s21c1
Sequence:CCGGAGAAGCAGCCTGCGGATATTCCTCGAGGAATATCCGCAGGCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-313s21c1
Sequence:CCGGATTAGACTCGGAGCAAGTAAGCTCGAGCTTACTTGCTCCGAGTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-569s21c1
Sequence:CCGGTCCACGACCAAGACAATTAAGCTCGAGCTTAATTGTCTTGGTCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-478s21c1
Sequence:CCGGGCGGGACCAAACTCCTTTAATCTCGAGATTAAAGGAGTTTGGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024622
PCNP MISSION shRNA shRNA Plasmid DNA
PEST proteolytic signal containing nuclear protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-528s21c1
Sequence:CCGGGAAGCTGTGGGAGCGAAATATCTCGAGATATTTCGCTCCCACAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024622.2-1964s21c1
Sequence:CCGGAGAAGCAGCCTGCGGATATTCCTCGAGGAATATCCGCAGGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-313s21c1
Sequence:CCGGATTAGACTCGGAGCAAGTAAGCTCGAGCTTACTTGCTCCGAGTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-569s21c1
Sequence:CCGGTCCACGACCAAGACAATTAAGCTCGAGCTTAATTGTCTTGGTCGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-478s21c1
Sequence:CCGGGCGGGACCAAACTCCTTTAATCTCGAGATTAAAGGAGTTTGGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024622
PCNP MISSION shRNA Lentiviral Transduction Particles
PEST proteolytic signal containing nuclear protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-528s21c1
Sequence:CCGGGAAGCTGTGGGAGCGAAATATCTCGAGATATTTCGCTCCCACAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024622.2-1964s21c1
Sequence:CCGGAGAAGCAGCCTGCGGATATTCCTCGAGGAATATCCGCAGGCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-313s21c1
Sequence:CCGGATTAGACTCGGAGCAAGTAAGCTCGAGCTTACTTGCTCCGAGTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-569s21c1
Sequence:CCGGTCCACGACCAAGACAATTAAGCTCGAGCTTAATTGTCTTGGTCGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024622.2-478s21c1
Sequence:CCGGGCGGGACCAAACTCCTTTAATCTCGAGATTAAAGGAGTTTGGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)