EMAIL THIS PAGE TO A FRIEND

PCNT

pericentrin

46 Gene Product Result for
Synonyms: KEN MOPD2 PCN PCNT2 PCNTB PCTN2 SCKL4
UniProtKB ID: O95613, O43152, Q7Z7C9
Gene ID:
Human(5116) Summary: The protein encoded by this gene binds to calmodulin and is expressed in the centrosome. It is an integral component of the pericentriolar material (PCM). The protein contains a series of coiled-coil domains and a highly conserved PCM targeting motif called the PACT domain near its C-terminus. The protein interacts with the microtubule nucleation component gamma-tubulin and is likely important to normal functioning of the centrosomes, cytoskeleton, and cell-cycle progression. Mutations in this gene cause Seckel syndrome-4 and microcephalic osteodysplastic primordial dwarfism type II. [provided by RefSeq, Jul 2008]
Mouse(18541) pericentrin (kendrin)
Rat(309692) pericentrin
chicken(424039) pericentrin
Horse(100055203) pericentrin
dog(491613) pericentrin
cow(510855) pericentrin
sheep(101107254) pericentrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006031 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020621 MISSION® esiRNA esiRNA targeting mouse Pcnt (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006031 Rosetta Predictions human pricing
XM_228081 Rosetta Predictions rat pricing
NM_008787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232727 predicted 6147
2 SASI_Hs01_00232728 predicted 3075
3 SASI_Hs02_00340762 predicted 3943
4 SASI_Hs01_00232730 predicted 2743
5 SASI_Hs01_00232731 predicted 9642
6 SASI_Hs01_00232732 predicted 7795
7 SASI_Hs01_00232733 predicted 1349
8 SASI_Hs01_00232734 predicted 6478
9 SASI_Hs01_00232736 predicted 3955
10 SASI_Hs02_00340763 predicted 4759
11 SASI_Hs01_00232729 predicted 4709
12 SASI_Hs01_00232735 predicted 10007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183608 predicted 10467
2 SASI_Rn01_00183609 predicted 11757
3 SASI_Rn01_00183610 predicted 674
4 SASI_Rn01_00183611 predicted 11931
5 SASI_Rn01_00183612 predicted 3087
6 SASI_Rn01_00183613 predicted 1830
7 SASI_Rn01_00183614 predicted 9684
8 SASI_Rn01_00183615 predicted 13097
9 SASI_Rn01_00183616 predicted 11214
10 SASI_Rn01_00183617 predicted 4331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098043 predicted 3325
2 SASI_Mm01_00098045 predicted 5089
3 SASI_Mm01_00098046 predicted 5588
4 SASI_Mm02_00314686 predicted 7136
5 SASI_Mm01_00098047 predicted 7791
6 SASI_Mm01_00098048 predicted 4561
7 SASI_Mm01_00098049 predicted 2464
8 SASI_Mm01_00098050 predicted 1834
9 SASI_Mm01_00098051 predicted 8641
10 SASI_Mm01_00098052 predicted 2199
11 SASI_Mm01_00098044 predicted 1882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008787
VALIDATED
PCNT MISSION shRNA Bacterial Glycerol Stock
pericentrin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8288s1c1
Sequence:CCGGGCTGCGTTCTTAATAGGCAAACTCGAGTTTGCCTATTAAGAACGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008787.2-9100s1c1
Sequence:CCGGCCTAAGGAAAGCCCATGATATCTCGAGATATCATGGGCTTTCCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-1482s21c1
Sequence:CCGGGGAGCACCTGAGGGTCTATTTCTCGAGAAATAGACCCTCAGGTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8992s1c1
Sequence:CCGGCCGCCAGATTCTACTCAGAAACTCGAGTTTCTGAGTAGAATCTGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-6654s21c1
Sequence:CCGGTTCAAACCTAGGAGATTATAACTCGAGTTATAATCTCCTAGGTTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-9047s21c1
Sequence:CCGGTAAAGTCCTTGCGGCTCTTAACTCGAGTTAAGAGCCGCAAGGACTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-8637s21c1
Sequence:CCGGTCGAGTGGTCATCGCAGTATTCTCGAGAATACTGCGATGACCACTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-742s21c1
Sequence:CCGGTTGACGGAGCTTCGGGAAATGCTCGAGCATTTCCCGAAGCTCCGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008787
VALIDATED
PCNT MISSION shRNA shRNA Plasmid DNA
pericentrin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8288s1c1
Sequence:CCGGGCTGCGTTCTTAATAGGCAAACTCGAGTTTGCCTATTAAGAACGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008787.2-9100s1c1
Sequence:CCGGCCTAAGGAAAGCCCATGATATCTCGAGATATCATGGGCTTTCCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-1482s21c1
Sequence:CCGGGGAGCACCTGAGGGTCTATTTCTCGAGAAATAGACCCTCAGGTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8992s1c1
Sequence:CCGGCCGCCAGATTCTACTCAGAAACTCGAGTTTCTGAGTAGAATCTGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-6654s21c1
Sequence:CCGGTTCAAACCTAGGAGATTATAACTCGAGTTATAATCTCCTAGGTTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-9047s21c1
Sequence:CCGGTAAAGTCCTTGCGGCTCTTAACTCGAGTTAAGAGCCGCAAGGACTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-8637s21c1
Sequence:CCGGTCGAGTGGTCATCGCAGTATTCTCGAGAATACTGCGATGACCACTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-742s21c1
Sequence:CCGGTTGACGGAGCTTCGGGAAATGCTCGAGCATTTCCCGAAGCTCCGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008787
VALIDATED
PCNT MISSION shRNA Lentiviral Transduction Particles
pericentrin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8288s1c1
Sequence:CCGGGCTGCGTTCTTAATAGGCAAACTCGAGTTTGCCTATTAAGAACGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008787.2-9100s1c1
Sequence:CCGGCCTAAGGAAAGCCCATGATATCTCGAGATATCATGGGCTTTCCTTAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-1482s21c1
Sequence:CCGGGGAGCACCTGAGGGTCTATTTCTCGAGAAATAGACCCTCAGGTGCTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008787.2-8992s1c1
Sequence:CCGGCCGCCAGATTCTACTCAGAAACTCGAGTTTCTGAGTAGAATCTGGCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-6654s21c1
Sequence:CCGGTTCAAACCTAGGAGATTATAACTCGAGTTATAATCTCCTAGGTTTGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-9047s21c1
Sequence:CCGGTAAAGTCCTTGCGGCTCTTAACTCGAGTTAAGAGCCGCAAGGACTTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-8637s21c1
Sequence:CCGGTCGAGTGGTCATCGCAGTATTCTCGAGAATACTGCGATGACCACTCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000247101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008787.3-742s21c1
Sequence:CCGGTTGACGGAGCTTCGGGAAATGCTCGAGCATTTCCCGAAGCTCCGTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006031
VALIDATED
PCNT MISSION shRNA Bacterial Glycerol Stock
pericentrin
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10124s1c1
Sequence:CCGGCGACAATTCTATTTGAGGAAACTCGAGTTTCCTCAAATAGAATTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-423s21c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-3068s1c1
Sequence:CCGGCGAGCAGACTTTGAGGAACAACTCGAGTTGTTCCTCAAAGTCTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10234s1c1
Sequence:CCGGGAATTAAGTGTCCTCACCTTTCTCGAGAAAGGTGAGGACACTTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-10123s1c1
Sequence:CCGGGCGACAATTCTATTTGAGGAACTCGAGTTCCTCAAATAGAATTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-2711s1c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-404s1c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-4743s1c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-2730s21c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-7913s21c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-1108s1c1
Sequence:CCGGCCAGATAGTAAAGACCCTGAACTCGAGTTCAGGGTCTTTACTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-9304s1c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-2206s1c1
Sequence:CCGGGCAGCATGAAACTCGTCTGAACTCGAGTTCAGACGAGTTTCATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-7894s1c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-9323s21c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-4762s21c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006031
VALIDATED
PCNT MISSION shRNA shRNA Plasmid DNA
pericentrin
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10124s1c1
Sequence:CCGGCGACAATTCTATTTGAGGAAACTCGAGTTTCCTCAAATAGAATTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-423s21c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-3068s1c1
Sequence:CCGGCGAGCAGACTTTGAGGAACAACTCGAGTTGTTCCTCAAAGTCTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10234s1c1
Sequence:CCGGGAATTAAGTGTCCTCACCTTTCTCGAGAAAGGTGAGGACACTTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-10123s1c1
Sequence:CCGGGCGACAATTCTATTTGAGGAACTCGAGTTCCTCAAATAGAATTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-2711s1c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-404s1c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-4743s1c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-2730s21c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-7913s21c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-1108s1c1
Sequence:CCGGCCAGATAGTAAAGACCCTGAACTCGAGTTCAGGGTCTTTACTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-9304s1c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-2206s1c1
Sequence:CCGGGCAGCATGAAACTCGTCTGAACTCGAGTTCAGACGAGTTTCATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-7894s1c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-9323s21c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-4762s21c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006031
VALIDATED
PCNT MISSION shRNA Lentiviral Transduction Particles
pericentrin
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10124s1c1
Sequence:CCGGCGACAATTCTATTTGAGGAAACTCGAGTTTCCTCAAATAGAATTGTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-423s21c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-3068s1c1
Sequence:CCGGCGAGCAGACTTTGAGGAACAACTCGAGTTGTTCCTCAAAGTCTGCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006031.3-10234s1c1
Sequence:CCGGGAATTAAGTGTCCTCACCTTTCTCGAGAAAGGTGAGGACACTTAATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-10123s1c1
Sequence:CCGGGCGACAATTCTATTTGAGGAACTCGAGTTCCTCAAATAGAATTGTCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-2711s1c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-404s1c1
Sequence:CCGGCAGAAGCAAGTCAATGACCATCTCGAGATGGTCATTGACTTGCTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000161774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-4743s1c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-2730s21c1
Sequence:CCGGCGTAAAGAGATCACCGAGAAACTCGAGTTTCTCGGTGATCTCTTTACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-7913s21c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-1108s1c1
Sequence:CCGGCCAGATAGTAAAGACCCTGAACTCGAGTTCAGGGTCTTTACTATCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-9304s1c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006031.3-2206s1c1
Sequence:CCGGGCAGCATGAAACTCGTCTGAACTCGAGTTCAGACGAGTTTCATGCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006031.3-7894s1c1
Sequence:CCGGGCAGACTGTAGTGCGAGATTTCTCGAGAAATCTCGCACTACAGTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-9323s21c1
Sequence:CCGGCGTGTCTAAGCTTGAGAAGTTCTCGAGAACTTCTCAAGCTTAGACACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006031.5-4762s21c1
Sequence:CCGGCGGCAGATAGACAAGTGTTAACTCGAGTTAACACTTGTCTATCTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???