EMAIL THIS PAGE TO A FRIEND

PCNX

pecanex homolog (Drosophila)

64 Gene Product Result for
Synonyms: PCNXL1
UniProtKB ID: Q96RV3, O94897, Q96AI7, Q9Y2J9
Gene ID:
Mouse(54604) pecanex homolog (Drosophila)
Rat(314288) pecanex homolog (Drosophila)
domestic guinea pig(100716462) pecanex homolog (Drosophila)
Domestic Rabbit(100341473) pecanex homolog (Drosophila)
naked mole-rat(101696311) pecanex homolog (Drosophila)
cow(788924) pecanex homolog (Drosophila)
sheep(101103403) pecanex homolog (Drosophila)
cow(514244) pecanex homolog (Drosophila)
Zebrafish(794337) pecanex homolog (Drosophila)
chicken(426230) pecanex homolog (Drosophila)
Horse(100054565) pecanex homolog (Drosophila)
dog(480378) pecanex homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053532 Anti-PCNX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014982 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014982 Rosetta Predictions human pricing
XM_001055794 Rosetta Predictions rat pricing
XM_234385 Rosetta Predictions rat pricing
NM_018814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246030 predicted 5862
2 SASI_Hs01_00246031 predicted 3182
3 SASI_Hs01_00246033 predicted 1368
4 SASI_Hs01_00246034 predicted 5534
5 SASI_Hs01_00246035 predicted 4570
6 SASI_Hs01_00246036 predicted 3235
7 SASI_Hs01_00246037 predicted 6405
8 SASI_Hs01_00246038 predicted 4777
9 SASI_Hs01_00246039 predicted 2074
10 SASI_Hs02_00346721 predicted 4424
11 SASI_Hs01_00246032 predicted 5224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281025 predicted 2751
2 SASI_Rn02_00281026 predicted 1665
3 SASI_Rn02_00281027 predicted 3361
4 SASI_Rn02_00281028 predicted 1649
5 SASI_Rn02_00281029 predicted 691
6 SASI_Rn02_00281030 predicted 2707
7 SASI_Rn02_00281031 predicted 5316
8 SASI_Rn02_00281032 predicted 3285
9 SASI_Rn02_00281033 predicted 3636
10 SASI_Rn02_00281034 predicted 3921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388439 predicted 2753
2 SASI_Rn02_00388440 predicted 1662
3 SASI_Rn02_00388441 predicted 3360
4 SASI_Rn02_00388442 predicted 1650
5 SASI_Rn02_00388443 predicted 695
6 SASI_Rn02_00388444 predicted 2705
7 SASI_Rn02_00388445 predicted 5317
8 SASI_Rn02_00388446 predicted 3288
9 SASI_Rn02_00388447 predicted 3633
10 SASI_Rn02_00388448 predicted 3919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031643 predicted 5446
2 SASI_Mm01_00031644 predicted 3089
3 SASI_Mm01_00031645 predicted 4376
4 SASI_Mm01_00031646 predicted 4343
5 SASI_Mm01_00031647 predicted 1984
6 SASI_Mm01_00031648 predicted 1923
7 SASI_Mm01_00031649 predicted 5803
8 SASI_Mm01_00031651 predicted 4802
9 SASI_Mm01_00031652 predicted 3972
10 SASI_Mm02_00324155 predicted 1280
11 SASI_Mm01_00031650 predicted 3045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018814
VALIDATED
PCNX MISSION shRNA Bacterial Glycerol Stock
pecanex homolog (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-5147s1c1
Sequence:CCGGCGATGATAAATACGTGACTATCTCGAGATAGTCACGTATTTATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018814.1-922s1c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-4879s1c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-3132s1c1
Sequence:CCGGCTGTCCTTTAACGCTGCGTTTCTCGAGAAACGCAGCGTTAAAGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-1124s1c1
Sequence:CCGGGCTGTGGATTGGCATCAACTTCTCGAGAAGTTGATGCCAATCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-3260s1c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3077s21c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-3530s1c1
Sequence:CCGGGACATGGTCATAATCGTATTACTCGAGTAATACGATTATGACCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018814.3-7773s1c1
Sequence:CCGGGAAGCATTTGGTTCGACATATCTCGAGATATGTCGAACCAAATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-5911s1c1
Sequence:CCGGGGAATCCGTATGTCCATTAAACTCGAGTTTAATGGACATACGGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-5430s21c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3531s21c1
Sequence:CCGGACATGGTCATAATCGTATTATCTCGAGATAATACGATTATGACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-7049s21c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018814
VALIDATED
PCNX MISSION shRNA shRNA Plasmid DNA
pecanex homolog (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-5147s1c1
Sequence:CCGGCGATGATAAATACGTGACTATCTCGAGATAGTCACGTATTTATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018814.1-922s1c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-4879s1c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-3132s1c1
Sequence:CCGGCTGTCCTTTAACGCTGCGTTTCTCGAGAAACGCAGCGTTAAAGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-1124s1c1
Sequence:CCGGGCTGTGGATTGGCATCAACTTCTCGAGAAGTTGATGCCAATCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-3260s1c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3077s21c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-3530s1c1
Sequence:CCGGGACATGGTCATAATCGTATTACTCGAGTAATACGATTATGACCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018814.3-7773s1c1
Sequence:CCGGGAAGCATTTGGTTCGACATATCTCGAGATATGTCGAACCAAATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-5911s1c1
Sequence:CCGGGGAATCCGTATGTCCATTAAACTCGAGTTTAATGGACATACGGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-5430s21c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3531s21c1
Sequence:CCGGACATGGTCATAATCGTATTATCTCGAGATAATACGATTATGACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-7049s21c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018814
VALIDATED
PCNX MISSION shRNA Lentiviral Transduction Particles
pecanex homolog (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-5147s1c1
Sequence:CCGGCGATGATAAATACGTGACTATCTCGAGATAGTCACGTATTTATCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018814.1-922s1c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-4879s1c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.1-3132s1c1
Sequence:CCGGCTGTCCTTTAACGCTGCGTTTCTCGAGAAACGCAGCGTTAAAGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-1124s1c1
Sequence:CCGGGCTGTGGATTGGCATCAACTTCTCGAGAAGTTGATGCCAATCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018814.1-3260s1c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3077s21c1
Sequence:CCGGCGGATTCTCATGTATCAAGTTCTCGAGAACTTGATACATGAGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-3530s1c1
Sequence:CCGGGACATGGTCATAATCGTATTACTCGAGTAATACGATTATGACCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018814.3-7773s1c1
Sequence:CCGGGAAGCATTTGGTTCGACATATCTCGAGATATGTCGAACCAAATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018814.3-5911s1c1
Sequence:CCGGGGAATCCGTATGTCCATTAAACTCGAGTTTAATGGACATACGGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-5430s21c1
Sequence:CCGGCCGAGTTCTTACCACCTACTACTCGAGTAGTAGGTGGTAAGAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018814.3-3531s21c1
Sequence:CCGGACATGGTCATAATCGTATTATCTCGAGATAATACGATTATGACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018814.3-7049s21c1
Sequence:CCGGCCAACATTTCCCATGCCAGAACTCGAGTTCTGGCATGGGAAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014982
PCNX MISSION shRNA Bacterial Glycerol Stock
pecanex homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-5058s1c1
Sequence:CCGGGCTTCCCAGCTTGATAGAAATCTCGAGATTTCTATCAAGCTGGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-6408s1c1
Sequence:CCGGCCTATTGGCTACCCAATCTTTCTCGAGAAAGATTGGGTAGCCAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2574s1c1
Sequence:CCGGCCTGAAAGTATAAAGCCCTTACTCGAGTAAGGGCTTTATACTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-7143s1c1
Sequence:CCGGGCCAACAATTCACACTCCAAACTCGAGTTTGGAGTGTGAATTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-945s1c1
Sequence:CCGGGCAGCAACTATTAAAGGAGATCTCGAGATCTCCTTTAATAGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2033s1c1
Sequence:CCGGGCGTAAAGATGTTGGTGGAAACTCGAGTTTCCACCAACATCTTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-2073s1c1
Sequence:CCGGCGACCTAAATCTTCTAGCGTACTCGAGTACGCTAGAAGATTTAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014982
PCNX MISSION shRNA shRNA Plasmid DNA
pecanex homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-5058s1c1
Sequence:CCGGGCTTCCCAGCTTGATAGAAATCTCGAGATTTCTATCAAGCTGGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-6408s1c1
Sequence:CCGGCCTATTGGCTACCCAATCTTTCTCGAGAAAGATTGGGTAGCCAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2574s1c1
Sequence:CCGGCCTGAAAGTATAAAGCCCTTACTCGAGTAAGGGCTTTATACTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-7143s1c1
Sequence:CCGGGCCAACAATTCACACTCCAAACTCGAGTTTGGAGTGTGAATTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-945s1c1
Sequence:CCGGGCAGCAACTATTAAAGGAGATCTCGAGATCTCCTTTAATAGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2033s1c1
Sequence:CCGGGCGTAAAGATGTTGGTGGAAACTCGAGTTTCCACCAACATCTTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-2073s1c1
Sequence:CCGGCGACCTAAATCTTCTAGCGTACTCGAGTACGCTAGAAGATTTAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014982
PCNX MISSION shRNA Lentiviral Transduction Particles
pecanex homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-5058s1c1
Sequence:CCGGGCTTCCCAGCTTGATAGAAATCTCGAGATTTCTATCAAGCTGGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-6408s1c1
Sequence:CCGGCCTATTGGCTACCCAATCTTTCTCGAGAAAGATTGGGTAGCCAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2574s1c1
Sequence:CCGGCCTGAAAGTATAAAGCCCTTACTCGAGTAAGGGCTTTATACTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-7143s1c1
Sequence:CCGGGCCAACAATTCACACTCCAAACTCGAGTTTGGAGTGTGAATTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-945s1c1
Sequence:CCGGGCAGCAACTATTAAAGGAGATCTCGAGATCTCCTTTAATAGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014982.1-2033s1c1
Sequence:CCGGGCGTAAAGATGTTGGTGGAAACTCGAGTTTCCACCAACATCTTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014982.1-2073s1c1
Sequence:CCGGCGACCTAAATCTTCTAGCGTACTCGAGTACGCTAGAAGATTTAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)