EMAIL THIS PAGE TO A FRIEND

PCNXL3

pecanex-like 3 (Drosophila)

80 Gene Product Result for
UniProtKB ID: Q9H6A9, Q6MZN8
Gene ID:
Mouse(104401) pecanex-like 3 (Drosophila)
Rat(309167) pecanex-like 3 (Drosophila)
domestic guinea pig(100731004) pecanex-like 3 (Drosophila)
naked mole-rat(101718009) pecanex-like 3 (Drosophila)
cow(536942) pecanex-like 3 (Drosophila)
sheep(101109226) pecanex-like 3 (Drosophila)
Zebrafish(100333869) pecanex-like 3 (Drosophila)
Horse(100057407) pecanex-like 3 (Drosophila)
domestic cat(101098892) pecanex-like 3 (Drosophila)
dog(483731) pecanex-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102111 MISSION® esiRNA esiRNA human AP001362.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032223 Rosetta Predictions human pricing
XM_374898 Rosetta Predictions human pricing
XM_934366 Rosetta Predictions human pricing
XM_934368 Rosetta Predictions human pricing
XM_001074181 Rosetta Predictions rat pricing
XM_219515 Rosetta Predictions rat pricing
NM_144868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359521 predicted 3278
2 SASI_Hs02_00359522 predicted 1468
3 SASI_Hs02_00359523 predicted 195
4 SASI_Hs02_00359524 predicted 4384
5 SASI_Hs02_00359525 predicted 3207
6 SASI_Hs02_00359526 predicted 4379
7 SASI_Hs02_00359527 predicted 3934
8 SASI_Hs02_00359528 predicted 3506
9 SASI_Hs02_00359529 predicted 411
10 SASI_Hs02_00359530 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286057 predicted 3811
2 SASI_Hs01_00286058 predicted 2006
3 SASI_Hs01_00286059 predicted 4634
4 SASI_Hs01_00286060 predicted 735
5 SASI_Hs01_00286061 predicted 4918
6 SASI_Hs01_00286062 predicted 1451
7 SASI_Hs01_00286063 predicted 4924
8 SASI_Hs01_00286064 predicted 3833
9 SASI_Hs01_00286065 predicted 4477
10 SASI_Hs01_00286066 predicted 4043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267982 predicted 1138
2 SASI_Hs01_00267983 predicted 2585
3 SASI_Hs01_00267984 predicted 1212
4 SASI_Hs01_00267985 predicted 1430
5 SASI_Hs01_00267986 predicted 1979
6 SASI_Hs01_00267987 predicted 1031
7 SASI_Hs01_00267988 predicted 3239
8 SASI_Hs01_00267989 predicted 1629
9 SASI_Hs01_00267990 predicted 986
10 SASI_Hs01_00267991 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277371 predicted 1246
2 SASI_Hs01_00277372 predicted 2065
3 SASI_Hs01_00277373 predicted 2415
4 SASI_Hs01_00277374 predicted 2356
5 SASI_Hs01_00277375 predicted 1273
6 SASI_Hs01_00277376 predicted 1911
7 SASI_Hs01_00277377 predicted 1476
8 SASI_Hs01_00277378 predicted 4170
9 SASI_Hs01_00277379 predicted 683
10 SASI_Hs01_00277380 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345320 predicted 1662
2 SASI_Rn02_00345321 predicted 2528
3 SASI_Rn02_00345322 predicted 1995
4 SASI_Rn02_00345323 predicted 3425
5 SASI_Rn02_00345324 predicted 945
6 SASI_Rn02_00345325 predicted 2704
7 SASI_Rn02_00345326 predicted 4252
8 SASI_Rn02_00345327 predicted 1309
9 SASI_Rn02_00345328 predicted 2806
10 SASI_Rn02_00345329 predicted 3508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378535 predicted 1656
2 SASI_Rn02_00378536 predicted 2526
3 SASI_Rn02_00378537 predicted 1998
4 SASI_Rn02_00378538 predicted 3427
5 SASI_Rn02_00378539 predicted 948
6 SASI_Rn02_00378540 predicted 2706
7 SASI_Rn02_00378541 predicted 4253
8 SASI_Rn02_00378542 predicted 1311
9 SASI_Rn02_00378543 predicted 2804
10 SASI_Rn02_00378544 predicted 3509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069722 predicted 4573
2 SASI_Mm02_00340297 predicted 4033
3 SASI_Mm01_00069724 predicted 6902
4 SASI_Mm01_00069725 predicted 5719
5 SASI_Mm01_00069726 predicted 1183
6 SASI_Mm01_00069728 predicted 2776
7 SASI_Mm01_00069729 predicted 2941
8 SASI_Mm01_00069730 predicted 2488
9 SASI_Mm01_00069731 predicted 4974
10 SASI_Mm02_00340298 predicted 2740
11 SASI_Mm01_00069723 predicted 1808
12 SASI_Mm01_00069727 predicted 3736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032223
VALIDATED
PCNXL3 MISSION shRNA Bacterial Glycerol Stock
pecanex-like 3 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-4445s21c1
Sequence:CCGGAGATCCTCATCACCTACTATGCTCGAGCATAGTAGGTGATGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-217s21c1
Sequence:CCGGACTATCAAGACTGTCAATTATCTCGAGATAATTGACAGTCTTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032223.2-1974s21c1
Sequence:CCGGTGAGGGTGCTGTGCACTATTTCTCGAGAAATAGTGCACAGCACCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-6127s21c1
Sequence:CCGGCACCTCCTAGGATTCAGTAACCTCGAGGTTACTGAATCCTAGGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-3928s21c1
Sequence:CCGGGAGCGCGACTACAACACTAAACTCGAGTTTAGTGTTGTAGTCGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032223
VALIDATED
PCNXL3 MISSION shRNA shRNA Plasmid DNA
pecanex-like 3 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-4445s21c1
Sequence:CCGGAGATCCTCATCACCTACTATGCTCGAGCATAGTAGGTGATGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-217s21c1
Sequence:CCGGACTATCAAGACTGTCAATTATCTCGAGATAATTGACAGTCTTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032223.2-1974s21c1
Sequence:CCGGTGAGGGTGCTGTGCACTATTTCTCGAGAAATAGTGCACAGCACCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-6127s21c1
Sequence:CCGGCACCTCCTAGGATTCAGTAACCTCGAGGTTACTGAATCCTAGGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-3928s21c1
Sequence:CCGGGAGCGCGACTACAACACTAAACTCGAGTTTAGTGTTGTAGTCGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032223
VALIDATED
PCNXL3 MISSION shRNA Lentiviral Transduction Particles
pecanex-like 3 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-4445s21c1
Sequence:CCGGAGATCCTCATCACCTACTATGCTCGAGCATAGTAGGTGATGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-217s21c1
Sequence:CCGGACTATCAAGACTGTCAATTATCTCGAGATAATTGACAGTCTTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032223.2-1974s21c1
Sequence:CCGGTGAGGGTGCTGTGCACTATTTCTCGAGAAATAGTGCACAGCACCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-6127s21c1
Sequence:CCGGCACCTCCTAGGATTCAGTAACCTCGAGGTTACTGAATCCTAGGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032223.2-3928s21c1
Sequence:CCGGGAGCGCGACTACAACACTAAACTCGAGTTTAGTGTTGTAGTCGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144868
VALIDATED
PCNXL3 MISSION shRNA Bacterial Glycerol Stock
pecanex-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.1-1494s1c1
Sequence:CCGGGTTCACCTTATGCTTTCCGTTCTCGAGAACGGAAAGCATAAGGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-5928s1c1
Sequence:CCGGCTTCCGAGTCATCAAGGTAAACTCGAGTTTACCTTGATGACTCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-1287s21c1
Sequence:CCGGGACCTCTGCCGATCGAGAAATCTCGAGATTTCTCGATCGGCAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-3991s21c1
Sequence:CCGGGTTCTGGGCTTCGTGTTATATCTCGAGATATAACACGAAGCCCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-6050s21c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-6050s1c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-6970s21c1
Sequence:CCGGACAACTCAGTGACCTAGACTTCTCGAGAAGTCTAGGTCACTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-3787s21c1
Sequence:CCGGTGGTCTCTAGTCCGGAGTAAACTCGAGTTTACTCCGGACTAGAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144868
VALIDATED
PCNXL3 MISSION shRNA shRNA Plasmid DNA
pecanex-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.1-1494s1c1
Sequence:CCGGGTTCACCTTATGCTTTCCGTTCTCGAGAACGGAAAGCATAAGGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-5928s1c1
Sequence:CCGGCTTCCGAGTCATCAAGGTAAACTCGAGTTTACCTTGATGACTCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-1287s21c1
Sequence:CCGGGACCTCTGCCGATCGAGAAATCTCGAGATTTCTCGATCGGCAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-3991s21c1
Sequence:CCGGGTTCTGGGCTTCGTGTTATATCTCGAGATATAACACGAAGCCCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-6050s21c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-6050s1c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-6970s21c1
Sequence:CCGGACAACTCAGTGACCTAGACTTCTCGAGAAGTCTAGGTCACTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-3787s21c1
Sequence:CCGGTGGTCTCTAGTCCGGAGTAAACTCGAGTTTACTCCGGACTAGAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144868
VALIDATED
PCNXL3 MISSION shRNA Lentiviral Transduction Particles
pecanex-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.1-1494s1c1
Sequence:CCGGGTTCACCTTATGCTTTCCGTTCTCGAGAACGGAAAGCATAAGGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-5928s1c1
Sequence:CCGGCTTCCGAGTCATCAAGGTAAACTCGAGTTTACCTTGATGACTCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-1287s21c1
Sequence:CCGGGACCTCTGCCGATCGAGAAATCTCGAGATTTCTCGATCGGCAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-3991s21c1
Sequence:CCGGGTTCTGGGCTTCGTGTTATATCTCGAGATATAACACGAAGCCCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144868.3-6050s21c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144868.3-6050s1c1
Sequence:CCGGCACTCCGCAACATGATCAATTCTCGAGAATTGATCATGTTGCGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-6970s21c1
Sequence:CCGGACAACTCAGTGACCTAGACTTCTCGAGAAGTCTAGGTCACTGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_144868.3-3787s21c1
Sequence:CCGGTGGTCTCTAGTCCGGAGTAAACTCGAGTTTACTCCGGACTAGAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)