EMAIL THIS PAGE TO A FRIEND

PCOLCE2

procollagen C-endopeptidase enhancer 2

58 Gene Product Result for
Synonyms: PCPE2
UniProtKB ID: Q9UKZ9, B2RCH9, D3DNG4, Q9BRH3
Gene ID:
Mouse(76477) procollagen C-endopeptidase enhancer 2
Rat(684050) procollagen C-endopeptidase enhancer 2
chicken(429124) procollagen C-endopeptidase enhancer 2
domestic cat(101096596) procollagen C-endopeptidase enhancer 2
dog(477102) procollagen C-endopeptidase enhancer 2
cow(513618) procollagen C-endopeptidase enhancer 2
sheep(101104952) procollagen C-endopeptidase enhancer 2
naked mole-rat(101703624) procollagen C-endopeptidase enhancer 2
Domestic Rabbit(100337915) procollagen C-endopeptidase enhancer 2
domestic guinea pig(100732973) procollagen C-endopeptidase enhancer 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013363 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046441 MISSION® esiRNA esiRNA human PCOLCE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013363 Rosetta Predictions human pricing
NM_001127640 Rosetta Predictions rat pricing
NM_029620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103277 predicted 1043
2 SASI_Hs01_00103278 predicted 543
3 SASI_Hs01_00103279 predicted 977
4 SASI_Hs01_00103281 predicted 806
5 SASI_Hs01_00103282 predicted 456
6 SASI_Hs01_00103283 predicted 282
7 SASI_Hs01_00103284 predicted 568
8 SASI_Hs02_00344697 predicted 823
9 SASI_Hs01_00103286 predicted 952
10 SASI_Hs02_00344698 predicted 722
11 SASI_Hs01_00103280 predicted 792
12 SASI_Hs01_00103285 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254730 predicted 1266
2 SASI_Rn02_00254731 predicted 1408
3 SASI_Rn02_00254732 predicted 1185
4 SASI_Rn02_00254733 predicted 337
5 SASI_Rn02_00254734 predicted 704
6 SASI_Rn02_00254735 predicted 403
7 SASI_Rn02_00254736 predicted 236
8 SASI_Rn02_00254737 predicted 603
9 SASI_Rn02_00254738 predicted 348
10 SASI_Rn02_00254739 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099595 predicted 418
2 SASI_Mm02_00335611 predicted 922
3 SASI_Mm01_00099596 predicted 365
4 SASI_Mm01_00099597 predicted 903
5 SASI_Mm01_00099598 predicted 725
6 SASI_Mm01_00099599 predicted 884
7 SASI_Mm01_00099600 predicted 1102
8 SASI_Mm01_00099601 predicted 609
9 SASI_Mm02_00335612 predicted 576
10 SASI_Mm01_00099602 predicted 529
11 SASI_Mm01_00099603 predicted 1180
12 SASI_Mm01_00099604 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029620
VALIDATED
PCOLCE2 MISSION shRNA Bacterial Glycerol Stock
procollagen C-endopeptidase enhancer 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-389s21c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-1277s21c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029620.2-1495s21c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-722s21c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-772s21c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029620.1-1496s1c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-390s1c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-1278s1c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-723s1c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-773s1c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029620
VALIDATED
PCOLCE2 MISSION shRNA shRNA Plasmid DNA
procollagen C-endopeptidase enhancer 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-389s21c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-1277s21c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029620.2-1495s21c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-722s21c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-772s21c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029620.1-1496s1c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-390s1c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-1278s1c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-723s1c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-773s1c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029620
VALIDATED
PCOLCE2 MISSION shRNA Lentiviral Transduction Particles
procollagen C-endopeptidase enhancer 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-389s21c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-1277s21c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029620.2-1495s21c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-722s21c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029620.2-772s21c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029620.1-1496s1c1
Sequence:CCGGCGCTATTTAATGCTGAGCGTTCTCGAGAACGCTCAGCATTAAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-390s1c1
Sequence:CCGGCGATTCATAGACCTGGAGAATCTCGAGATTCTCCAGGTCTATGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-1278s1c1
Sequence:CCGGCGAGGTCTCAATTACATTATTCTCGAGAATAATGTAATTGAGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-723s1c1
Sequence:CCGGGCTCCGAAGAACCAGCTTATACTCGAGTATAAGCTGGTTCTTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029620.1-773s1c1
Sequence:CCGGGCGCGATAACTACTGCAGATACTCGAGTATCTGCAGTAGTTATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013363
VALIDATED
PCOLCE2 MISSION shRNA Bacterial Glycerol Stock
procollagen C-endopeptidase enhancer 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-1369s21c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013363.2-1466s21c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-305s21c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1762s21c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1452s21c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-1369s1c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1452s1c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-409s1c1
Sequence:CCGGCGTTCTCAATTTCCGATTCATCTCGAGATGAATCGGAAATTGAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1762s1c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-907s1c1
Sequence:CCGGGCCAATTGTGTCTGAGAGAAACTCGAGTTTCTCTCAGACACAATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-906s1c1
Sequence:CCGGCGCCAATTGTGTCTGAGAGAACTCGAGTTCTCTCAGACACAATTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-820s1c1
Sequence:CCGGCCGATATGATTATGTGGCTGTCTCGAGACAGCCACATAATCATATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1466s1c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013363.2-1048s1c1
Sequence:CCGGCCCTGTAACCACGGGTTTAAACTCGAGTTTAAACCCGTGGTTACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-305s1c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013363
VALIDATED
PCOLCE2 MISSION shRNA shRNA Plasmid DNA
procollagen C-endopeptidase enhancer 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-1369s21c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013363.2-1466s21c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-305s21c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1762s21c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1452s21c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-1369s1c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1452s1c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-409s1c1
Sequence:CCGGCGTTCTCAATTTCCGATTCATCTCGAGATGAATCGGAAATTGAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1762s1c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-907s1c1
Sequence:CCGGGCCAATTGTGTCTGAGAGAAACTCGAGTTTCTCTCAGACACAATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-906s1c1
Sequence:CCGGCGCCAATTGTGTCTGAGAGAACTCGAGTTCTCTCAGACACAATTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-820s1c1
Sequence:CCGGCCGATATGATTATGTGGCTGTCTCGAGACAGCCACATAATCATATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1466s1c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013363.2-1048s1c1
Sequence:CCGGCCCTGTAACCACGGGTTTAAACTCGAGTTTAAACCCGTGGTTACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-305s1c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013363
VALIDATED
PCOLCE2 MISSION shRNA Lentiviral Transduction Particles
procollagen C-endopeptidase enhancer 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-1369s21c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013363.2-1466s21c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013363.2-305s21c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1762s21c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_013363.2-1452s21c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-1369s1c1
Sequence:CCGGGCCAAACAGCTTTATCATGATCTCGAGATCATGATAAAGCTGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1452s1c1
Sequence:CCGGCTGTGTCCATTTAAGCTGTATCTCGAGATACAGCTTAAATGGACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-409s1c1
Sequence:CCGGCGTTCTCAATTTCCGATTCATCTCGAGATGAATCGGAAATTGAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1762s1c1
Sequence:CCGGGAGTTGTGTGAAGATGTCAAACTCGAGTTTGACATCTTCACACAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-907s1c1
Sequence:CCGGGCCAATTGTGTCTGAGAGAAACTCGAGTTTCTCTCAGACACAATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-906s1c1
Sequence:CCGGCGCCAATTGTGTCTGAGAGAACTCGAGTTCTCTCAGACACAATTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013363.2-820s1c1
Sequence:CCGGCCGATATGATTATGTGGCTGTCTCGAGACAGCCACATAATCATATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013363.2-1466s1c1
Sequence:CCGGGCTGTATTCTGCCATTGCCTTCTCGAGAAGGCAATGGCAGAATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013363.2-1048s1c1
Sequence:CCGGCCCTGTAACCACGGGTTTAAACTCGAGTTTAAACCCGTGGTTACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013363.2-305s1c1
Sequence:CCGGCTTACTGGAGAGTCTGGATTTCTCGAGAAATCCAGACTCTCCAGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)