EMAIL THIS PAGE TO A FRIEND

PCP2

Purkinje cell protein 2

65 Gene Product Result for
Synonyms: GPSM4
UniProtKB ID: Q8IVA1, Q3KRG7
Gene ID:
Mouse(18545) Purkinje cell protein 2 (L7)
Rat(304195) Purkinje cell protein 2
Horse(100060709) Purkinje cell protein 2
domestic cat(101097214) Purkinje cell protein 2
dog(484996) Purkinje cell protein 2
cow(617132) Purkinje cell protein 2
sheep(101123631) Purkinje cell protein 2
domestic guinea pig(100714752) Purkinje cell protein 2
naked mole-rat(101700887) Purkinje cell protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174895 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036981 MISSION® esiRNA esiRNA human PCP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174895 Rosetta Predictions human pricing
NM_001107116 Rosetta Predictions rat pricing
NM_001129803 Rosetta Predictions mouse pricing
NM_001129804 Rosetta Predictions mouse pricing
NM_008790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103641 predicted 450
2 SASI_Hs01_00103642 predicted 326
3 SASI_Hs01_00103644 predicted 451
4 SASI_Hs01_00103645 predicted 290
5 SASI_Hs01_00103646 predicted 448
6 SASI_Hs01_00103647 predicted 280
7 SASI_Hs01_00103648 predicted 459
8 SASI_Hs02_00368781 predicted 442
9 SASI_Hs01_00103649 predicted 442
10 SASI_Hs01_00103650 predicted 443
11 SASI_Hs01_00103643 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225656 predicted 215
2 SASI_Rn02_00225657 predicted 206
3 SASI_Rn02_00225658 predicted 218
4 SASI_Rn02_00225659 predicted 213
5 SASI_Rn02_00225660 predicted 225
6 SASI_Rn02_00225661 predicted 205
7 SASI_Rn02_00225662 predicted 216
8 SASI_Rn02_00225663 predicted 242
9 SASI_Rn02_00225664 predicted 221
10 SASI_Rn02_00225665 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310778 predicted 254
2 SASI_Mm02_00310779 predicted 256
3 SASI_Mm02_00310780 predicted 250
4 SASI_Mm02_00310781 predicted 207
5 SASI_Mm02_00310782 predicted 254
6 SASI_Mm02_00310783 predicted 253
7 SASI_Mm02_00310784 predicted 259
8 SASI_Mm02_00310785 predicted 207
9 SASI_Mm02_00310786 predicted 212
10 SASI_Mm02_00310787 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001129804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310788 predicted 231
2 SASI_Mm02_00310789 predicted 233
3 SASI_Mm02_00310790 predicted 226
4 SASI_Mm02_00310791 predicted 227
5 SASI_Mm02_00310792 predicted 223
6 SASI_Mm02_00310793 predicted 233
7 SASI_Mm02_00310794 predicted 220
8 SASI_Mm02_00310795 predicted 228
9 SASI_Mm02_00310796 predicted 206
10 SASI_Mm02_00310797 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185484 predicted 257
2 SASI_Mm01_00185485 predicted 252
3 SASI_Mm01_00185486 predicted 244
4 SASI_Mm01_00185487 predicted 211
5 SASI_Mm01_00185488 predicted 248
6 SASI_Mm01_00185489 predicted 250
7 SASI_Mm01_00185490 predicted 256
8 SASI_Mm02_00314690 predicted 202
9 SASI_Mm01_00185491 predicted 218
10 SASI_Mm01_00185492 predicted 251
11 SASI_Mm01_00185493 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008790
PCP2 MISSION shRNA Bacterial Glycerol Stock
Purkinje cell protein 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-202s1c1
Sequence:CCGGTCCAGAGATGGACAATCTCATCTCGAGATGAGATTGTCCATCTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-269s1c1
Sequence:CCGGGTAACAGTTAATTCCCTGCCTCTCGAGAGGCAGGGAATTAACTGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-308s1c1
Sequence:CCGGCCCAAGGATGGAATGCAGAAACTCGAGTTTCTGCATTCCATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008790
PCP2 MISSION shRNA shRNA Plasmid DNA
Purkinje cell protein 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-202s1c1
Sequence:CCGGTCCAGAGATGGACAATCTCATCTCGAGATGAGATTGTCCATCTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-269s1c1
Sequence:CCGGGTAACAGTTAATTCCCTGCCTCTCGAGAGGCAGGGAATTAACTGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-308s1c1
Sequence:CCGGCCCAAGGATGGAATGCAGAAACTCGAGTTTCTGCATTCCATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008790
PCP2 MISSION shRNA Lentiviral Transduction Particles
Purkinje cell protein 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-202s1c1
Sequence:CCGGTCCAGAGATGGACAATCTCATCTCGAGATGAGATTGTCCATCTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-269s1c1
Sequence:CCGGGTAACAGTTAATTCCCTGCCTCTCGAGAGGCAGGGAATTAACTGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008790.2-308s1c1
Sequence:CCGGCCCAAGGATGGAATGCAGAAACTCGAGTTTCTGCATTCCATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174895
PCP2 MISSION shRNA Bacterial Glycerol Stock
Purkinje cell protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-339s21c1
Sequence:CCGGATGGAGGGACAGCGCTGTTCACTCGAGTGAACAGCGCTGTCCCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-458s21c1
Sequence:CCGGCATGGATGACCAACGTGTGACCTCGAGGTCACACGTTGGTCATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-513s21c1
Sequence:CCGGTCCAAGGACGGAGCACAGAAACTCGAGTTTCTGTGCTCCGTCCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-292s21c1
Sequence:CCGGACCAGGAGGGCTTCTTCAATCCTCGAGGATTGAAGAAGCCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-413s21c1
Sequence:CCGGGATGGACAGCCTCATGGACATCTCGAGATGTCCATGAGGCTGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174895
PCP2 MISSION shRNA shRNA Plasmid DNA
Purkinje cell protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-339s21c1
Sequence:CCGGATGGAGGGACAGCGCTGTTCACTCGAGTGAACAGCGCTGTCCCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-458s21c1
Sequence:CCGGCATGGATGACCAACGTGTGACCTCGAGGTCACACGTTGGTCATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-513s21c1
Sequence:CCGGTCCAAGGACGGAGCACAGAAACTCGAGTTTCTGTGCTCCGTCCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-292s21c1
Sequence:CCGGACCAGGAGGGCTTCTTCAATCCTCGAGGATTGAAGAAGCCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-413s21c1
Sequence:CCGGGATGGACAGCCTCATGGACATCTCGAGATGTCCATGAGGCTGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174895
PCP2 MISSION shRNA Lentiviral Transduction Particles
Purkinje cell protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-339s21c1
Sequence:CCGGATGGAGGGACAGCGCTGTTCACTCGAGTGAACAGCGCTGTCCCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-458s21c1
Sequence:CCGGCATGGATGACCAACGTGTGACCTCGAGGTCACACGTTGGTCATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-513s21c1
Sequence:CCGGTCCAAGGACGGAGCACAGAAACTCGAGTTTCTGTGCTCCGTCCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-292s21c1
Sequence:CCGGACCAGGAGGGCTTCTTCAATCCTCGAGGATTGAAGAAGCCCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174895.1-413s21c1
Sequence:CCGGGATGGACAGCCTCATGGACATCTCGAGATGTCCATGAGGCTGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)