EMAIL THIS PAGE TO A FRIEND

PCP4

Purkinje cell protein 4

49 Gene Product Result for
Synonyms: PEP-19
UniProtKB ID: P48539, A6NDJ9, Q6ICS4, Q93059
Gene ID:
Mouse(18546) Purkinje cell protein 4
Rat(25510) Purkinje cell protein 4
naked mole-rat(101722392) Purkinje cell protein 4
domestic guinea pig(100730425) Purkinje cell protein 4
cow(768324) Purkinje cell protein 4
sheep(101119182) Purkinje cell protein 4
chicken(771220) Purkinje cell protein 4
dog(610723) Purkinje cell protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006198 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028471 MISSION® esiRNA esiRNA human PCP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006198 Rosetta Predictions human pricing
NM_013002 Rosetta Predictions rat pricing
NM_008791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118358 predicted 206
2 SASI_Hs01_00118359 predicted 244
3 SASI_Hs02_00341090 predicted 313
4 SASI_Hs01_00118360 predicted 205
5 SASI_Hs01_00118361 predicted 308
6 SASI_Hs01_00118362 predicted 300
7 SASI_Hs01_00118363 predicted 254
8 SASI_Hs01_00118364 predicted 313
9 SASI_Hs01_00118365 predicted 298
10 SASI_Hs02_00341091 predicted 235
11 SASI_Hs01_00118366 predicted 220
12 SASI_Hs01_00118367 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117847 predicted 249
2 SASI_Rn01_00117848 predicted 285
3 SASI_Rn01_00117849 predicted 218
4 SASI_Rn01_00117851 predicted 287
5 SASI_Rn01_00117852 predicted 285
6 SASI_Rn01_00117853 predicted 263
7 SASI_Rn01_00117854 predicted 285
8 SASI_Rn02_00260656 predicted 294
9 SASI_Rn02_00260657 predicted 262
10 SASI_Rn02_00260658 predicted 284
11 SASI_Rn01_00117850 predicted 291
12 SASI_Rn01_00117855 predicted 285
13 SASI_Rn01_00117856 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046336 predicted 216
2 SASI_Mm01_00046338 predicted 251
3 SASI_Mm01_00046339 predicted 219
4 SASI_Mm01_00046340 predicted 364
5 SASI_Mm01_00046341 predicted 302
6 SASI_Mm01_00046342 predicted 349
7 SASI_Mm01_00046343 predicted 213
8 SASI_Mm02_00314691 predicted 403
9 SASI_Mm01_00046344 predicted 384
10 SASI_Mm01_00046345 predicted 349
11 SASI_Mm01_00046337 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008791
PCP4 MISSION shRNA Bacterial Glycerol Stock
Purkinje cell protein 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-97s1c1
Sequence:CCGGGAAGAATTTGATATCGACATGCTCGAGCATGTCGATATCAAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-63s1c1
Sequence:CCGGGTCAGGAGATAATGATGGGCACTCGAGTGCCCATCATTATCTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-81s1c1
Sequence:CCGGGCAGAAGAAAGTCCAAGAAGACTCGAGTCTTCTTGGACTTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-91s1c1
Sequence:CCGGGTCCAAGAAGAATTTGATATCCTCGAGGATATCAAATTCTTCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-65s1c1
Sequence:CCGGCAGGAGATAATGATGGGCAGACTCGAGTCTGCCCATCATTATCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-57s1c1
Sequence:CCGGCAAGACGTCAGGAGATAATGACTCGAGTCATTATCTCCTGACGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-82s1c1
Sequence:CCGGCAGAAGAAAGTCCAAGAAGAACTCGAGTTCTTCTTGGACTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-100s1c1
Sequence:CCGGGAATTTGATATCGACATGGATCTCGAGATCCATGTCGATATCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008791
PCP4 MISSION shRNA shRNA Plasmid DNA
Purkinje cell protein 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-97s1c1
Sequence:CCGGGAAGAATTTGATATCGACATGCTCGAGCATGTCGATATCAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-63s1c1
Sequence:CCGGGTCAGGAGATAATGATGGGCACTCGAGTGCCCATCATTATCTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-81s1c1
Sequence:CCGGGCAGAAGAAAGTCCAAGAAGACTCGAGTCTTCTTGGACTTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-91s1c1
Sequence:CCGGGTCCAAGAAGAATTTGATATCCTCGAGGATATCAAATTCTTCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-65s1c1
Sequence:CCGGCAGGAGATAATGATGGGCAGACTCGAGTCTGCCCATCATTATCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-57s1c1
Sequence:CCGGCAAGACGTCAGGAGATAATGACTCGAGTCATTATCTCCTGACGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-82s1c1
Sequence:CCGGCAGAAGAAAGTCCAAGAAGAACTCGAGTTCTTCTTGGACTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-100s1c1
Sequence:CCGGGAATTTGATATCGACATGGATCTCGAGATCCATGTCGATATCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008791
PCP4 MISSION shRNA Lentiviral Transduction Particles
Purkinje cell protein 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-97s1c1
Sequence:CCGGGAAGAATTTGATATCGACATGCTCGAGCATGTCGATATCAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-63s1c1
Sequence:CCGGGTCAGGAGATAATGATGGGCACTCGAGTGCCCATCATTATCTCCTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-81s1c1
Sequence:CCGGGCAGAAGAAAGTCCAAGAAGACTCGAGTCTTCTTGGACTTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-91s1c1
Sequence:CCGGGTCCAAGAAGAATTTGATATCCTCGAGGATATCAAATTCTTCTTGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-65s1c1
Sequence:CCGGCAGGAGATAATGATGGGCAGACTCGAGTCTGCCCATCATTATCTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-57s1c1
Sequence:CCGGCAAGACGTCAGGAGATAATGACTCGAGTCATTATCTCCTGACGTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-82s1c1
Sequence:CCGGCAGAAGAAAGTCCAAGAAGAACTCGAGTTCTTCTTGGACTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008791.1-100s1c1
Sequence:CCGGGAATTTGATATCGACATGGATCTCGAGATCCATGTCGATATCAAATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006198
PCP4 MISSION shRNA Bacterial Glycerol Stock
Purkinje cell protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-382s1c1
Sequence:CCGGGCATAGCAAACCTCCAATGCACTCGAGTGCATTGGAGGTTTGCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-119s1c1
Sequence:CCGGGATGGACAGAAGAAAGTTCAACTCGAGTTGAACTTTCTTCTGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-140s1c1
Sequence:CCGGGAAGAATTTGACATTGACATGCTCGAGCATGTCAATGTCAAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-125s1c1
Sequence:CCGGCAGAAGAAAGTTCAAGAAGAACTCGAGTTCTTCTTGAACTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-214s1c1
Sequence:CCGGGCCATTCAGTCTCAGTTCAGACTCGAGTCTGAACTGAGACTGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-215s1c1
Sequence:CCGGCCATTCAGTCTCAGTTCAGAACTCGAGTTCTGAACTGAGACTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-400s1c1
Sequence:CCGGGCATGTACAGAAACCTGTGATCTCGAGATCACAGGTTTCTGTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-311s1c1
Sequence:CCGGCAACCATCATCTGTCAAGAAACTCGAGTTTCTTGACAGATGATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-401s1c1
Sequence:CCGGCATGTACAGAAACCTGTGATACTCGAGTATCACAGGTTTCTGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006198
PCP4 MISSION shRNA shRNA Plasmid DNA
Purkinje cell protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-382s1c1
Sequence:CCGGGCATAGCAAACCTCCAATGCACTCGAGTGCATTGGAGGTTTGCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-119s1c1
Sequence:CCGGGATGGACAGAAGAAAGTTCAACTCGAGTTGAACTTTCTTCTGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-140s1c1
Sequence:CCGGGAAGAATTTGACATTGACATGCTCGAGCATGTCAATGTCAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-125s1c1
Sequence:CCGGCAGAAGAAAGTTCAAGAAGAACTCGAGTTCTTCTTGAACTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-214s1c1
Sequence:CCGGGCCATTCAGTCTCAGTTCAGACTCGAGTCTGAACTGAGACTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-215s1c1
Sequence:CCGGCCATTCAGTCTCAGTTCAGAACTCGAGTTCTGAACTGAGACTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-400s1c1
Sequence:CCGGGCATGTACAGAAACCTGTGATCTCGAGATCACAGGTTTCTGTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-311s1c1
Sequence:CCGGCAACCATCATCTGTCAAGAAACTCGAGTTTCTTGACAGATGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-401s1c1
Sequence:CCGGCATGTACAGAAACCTGTGATACTCGAGTATCACAGGTTTCTGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006198
PCP4 MISSION shRNA Lentiviral Transduction Particles
Purkinje cell protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-382s1c1
Sequence:CCGGGCATAGCAAACCTCCAATGCACTCGAGTGCATTGGAGGTTTGCTATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-119s1c1
Sequence:CCGGGATGGACAGAAGAAAGTTCAACTCGAGTTGAACTTTCTTCTGTCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-140s1c1
Sequence:CCGGGAAGAATTTGACATTGACATGCTCGAGCATGTCAATGTCAAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.1-125s1c1
Sequence:CCGGCAGAAGAAAGTTCAAGAAGAACTCGAGTTCTTCTTGAACTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-214s1c1
Sequence:CCGGGCCATTCAGTCTCAGTTCAGACTCGAGTCTGAACTGAGACTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006198.2-215s1c1
Sequence:CCGGCCATTCAGTCTCAGTTCAGAACTCGAGTTCTGAACTGAGACTGAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-400s1c1
Sequence:CCGGGCATGTACAGAAACCTGTGATCTCGAGATCACAGGTTTCTGTACATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-311s1c1
Sequence:CCGGCAACCATCATCTGTCAAGAAACTCGAGTTTCTTGACAGATGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006198.2-401s1c1
Sequence:CCGGCATGTACAGAAACCTGTGATACTCGAGTATCACAGGTTTCTGTACATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)