EMAIL THIS PAGE TO A FRIEND

PCSK1N

proprotein convertase subtilisin/kexin type 1 inhibitor

58 Gene Product Result for
Synonyms: PROSAAS SAAS
UniProtKB ID: Q9UHG2, Q4VC04
Gene ID:
Human(27344) Summary: Members of the subtilisin-like proprotein convertase family process latent precursor proteins into their biologically active products. The protein encoded by this gene functions as an inhibitor of prohormone convertase 1, which regulates the proteolytic cleavage of neuroendocrine peptide precursors. [provided by RefSeq, Nov 2012]
Mouse(30052) proprotein convertase subtilisin/kexin type 1 inhibitor
Rat(246333) proprotein convertase subtilisin/kexin type 1 inhibitor
domestic guinea pig(100731521) proprotein convertase subtilisin/kexin type 1 inhibitor
naked mole-rat(101709171) proprotein convertase subtilisin/kexin type 1 inhibitor
cow(513603) proprotein convertase subtilisin/kexin type 1 inhibitor
sheep(101113828) proprotein convertase subtilisin/kexin type 1 inhibitor
domestic cat(101096704) proprotein convertase subtilisin/kexin type 1 inhibitor
dog(491870) proprotein convertase subtilisin/kexin type 1 inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013271 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013271 Rosetta Predictions human pricing
NM_019279 Rosetta Predictions rat pricing
NM_013892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057323 predicted 733
2 SASI_Hs01_00057324 predicted 745
3 SASI_Hs01_00057325 predicted 732
4 SASI_Hs01_00057326 predicted 160
5 SASI_Hs01_00057327 predicted 845
6 SASI_Hs02_00344510 predicted 160
7 SASI_Hs01_00057329 predicted 150
8 SASI_Hs01_00057330 predicted 112
9 SASI_Hs01_00057331 predicted 146
10 SASI_Hs02_00344511 predicted 821
11 SASI_Hs01_00057328 predicted 688
12 SASI_Hs01_00057332 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076382 predicted 457
2 SASI_Rn01_00076383 predicted 705
3 SASI_Rn01_00076384 predicted 615
4 SASI_Rn01_00076385 predicted 399
5 SASI_Rn01_00076386 predicted 587
6 SASI_Rn02_00262203 predicted 404
7 SASI_Rn02_00262204 predicted 462
8 SASI_Rn02_00262205 predicted 612
9 SASI_Rn02_00262206 predicted 281
10 SASI_Rn02_00262207 predicted 455
11 SASI_Rn01_00076379 predicted 222
12 SASI_Rn01_00076380 predicted 583
13 SASI_Rn01_00076381 predicted 674
14 SASI_Rn01_00076387 predicted 568
15 SASI_Rn01_00076388 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110023 predicted 757
2 SASI_Mm01_00110024 predicted 490
3 SASI_Mm01_00110025 predicted 675
4 SASI_Mm01_00110026 predicted 247
5 SASI_Mm01_00110027 predicted 228
6 SASI_Mm01_00110028 predicted 243
7 SASI_Mm01_00110029 predicted 698
8 SASI_Mm01_00110030 predicted 653
9 SASI_Mm01_00110031 predicted 541
10 SASI_Mm02_00322948 predicted 546
11 SASI_Mm01_00110022 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013271
PCSK1N MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 1 inhibitor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-267s21c1
Sequence:CCGGCATCTGCTGGAGGCCGAACGTCTCGAGACGTTCGGCCTCCAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-85s21c1
Sequence:CCGGTGCTGCTGCTCGGCCTGTTTCCTCGAGGAAACAGGCCGAGCAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-690s1c2
Sequence:CCGGGCCGACCACGATGTGGGCTCTCTCGAGAGAGCCCACATCGTGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-615s21c1
Sequence:CCGGTACTTGCTGGGACGGATTCTTCTCGAGAAGAATCCGTCCCAGCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-743s1c1
Sequence:CCGGGCTGCGTGTGAAACGCCTAGACTCGAGTCTAGGCGTTTCACACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-600s1c1
Sequence:CCGGCCCGAGCTGTTGAGGTACTTGCTCGAGCAAGTACCTCAACAGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-165s1c1
Sequence:CCGGTCTCCGCCCTTGGCTGAGACTCTCGAGAGTCTCAGCCAAGGGCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-374s1c1
Sequence:CCGGCCGCAACTCTGATCCGGCTCTCTCGAGAGAGCCGGATCAGAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013271
PCSK1N MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 1 inhibitor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-267s21c1
Sequence:CCGGCATCTGCTGGAGGCCGAACGTCTCGAGACGTTCGGCCTCCAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-85s21c1
Sequence:CCGGTGCTGCTGCTCGGCCTGTTTCCTCGAGGAAACAGGCCGAGCAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-690s1c2
Sequence:CCGGGCCGACCACGATGTGGGCTCTCTCGAGAGAGCCCACATCGTGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-615s21c1
Sequence:CCGGTACTTGCTGGGACGGATTCTTCTCGAGAAGAATCCGTCCCAGCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-743s1c1
Sequence:CCGGGCTGCGTGTGAAACGCCTAGACTCGAGTCTAGGCGTTTCACACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-600s1c1
Sequence:CCGGCCCGAGCTGTTGAGGTACTTGCTCGAGCAAGTACCTCAACAGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-165s1c1
Sequence:CCGGTCTCCGCCCTTGGCTGAGACTCTCGAGAGTCTCAGCCAAGGGCGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-374s1c1
Sequence:CCGGCCGCAACTCTGATCCGGCTCTCTCGAGAGAGCCGGATCAGAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013271
PCSK1N MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 1 inhibitor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-267s21c1
Sequence:CCGGCATCTGCTGGAGGCCGAACGTCTCGAGACGTTCGGCCTCCAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-85s21c1
Sequence:CCGGTGCTGCTGCTCGGCCTGTTTCCTCGAGGAAACAGGCCGAGCAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-690s1c2
Sequence:CCGGGCCGACCACGATGTGGGCTCTCTCGAGAGAGCCCACATCGTGGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013271.2-615s21c1
Sequence:CCGGTACTTGCTGGGACGGATTCTTCTCGAGAAGAATCCGTCCCAGCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-743s1c1
Sequence:CCGGGCTGCGTGTGAAACGCCTAGACTCGAGTCTAGGCGTTTCACACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-600s1c1
Sequence:CCGGCCCGAGCTGTTGAGGTACTTGCTCGAGCAAGTACCTCAACAGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-165s1c1
Sequence:CCGGTCTCCGCCCTTGGCTGAGACTCTCGAGAGTCTCAGCCAAGGGCGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013271.2-374s1c1
Sequence:CCGGCCGCAACTCTGATCCGGCTCTCTCGAGAGAGCCGGATCAGAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013892
PCSK1N MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 1 inhibitor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-823s1c1
Sequence:CCGGACGCGTCAAACGCCTGGAGAACTCGAGTTCTCCAGGCGTTTGACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-759s1c1
Sequence:CCGGGCCGATCTGTGGACCAGGATTCTCGAGAATCCTGGTCCACAGATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-254s1c1
Sequence:CCGGCCCTTGGTTGAGACGAGCACTCTCGAGAGTGCTCGTCTCAACCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-652s1c1
Sequence:CCGGCGGCGACGAGACTCCTGACGTCTCGAGACGTCAGGAGTCTCGTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-202s1c1
Sequence:CCGGCCTGTCAGCGAGGCCCGTGAACTCGAGTTCACGGGCCTCGCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013892
PCSK1N MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 1 inhibitor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-823s1c1
Sequence:CCGGACGCGTCAAACGCCTGGAGAACTCGAGTTCTCCAGGCGTTTGACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-759s1c1
Sequence:CCGGGCCGATCTGTGGACCAGGATTCTCGAGAATCCTGGTCCACAGATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-254s1c1
Sequence:CCGGCCCTTGGTTGAGACGAGCACTCTCGAGAGTGCTCGTCTCAACCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-652s1c1
Sequence:CCGGCGGCGACGAGACTCCTGACGTCTCGAGACGTCAGGAGTCTCGTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-202s1c1
Sequence:CCGGCCTGTCAGCGAGGCCCGTGAACTCGAGTTCACGGGCCTCGCTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013892
PCSK1N MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 1 inhibitor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-823s1c1
Sequence:CCGGACGCGTCAAACGCCTGGAGAACTCGAGTTCTCCAGGCGTTTGACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-759s1c1
Sequence:CCGGGCCGATCTGTGGACCAGGATTCTCGAGAATCCTGGTCCACAGATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-254s1c1
Sequence:CCGGCCCTTGGTTGAGACGAGCACTCTCGAGAGTGCTCGTCTCAACCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-652s1c1
Sequence:CCGGCGGCGACGAGACTCCTGACGTCTCGAGACGTCAGGAGTCTCGTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013892.2-202s1c1
Sequence:CCGGCCTGTCAGCGAGGCCCGTGAACTCGAGTTCACGGGCCTCGCTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)