EMAIL THIS PAGE TO A FRIEND

PCSK2

proprotein convertase subtilisin/kexin type 2

112 Gene Product Result for
Synonyms: NEC 2 NEC-2 NEC2 PC2 SPC2
Gene ID:
Human(5126) Summary: This gene encodes a member of the subtilisin-like proprotein convertase family. These enzymes process latent precursor proteins into their biologically active products. The encoded protein plays a critical role in hormone biosynthesis by processing a variety of prohormones including proinsulin, proopiomelanocortin and proluteinizing-hormone-releasing hormone. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(18549) proprotein convertase subtilisin/kexin type 2
Rat(25121) proprotein convertase subtilisin/kexin type 2
Zebrafish(100004460) proprotein convertase subtilisin/kexin type 2
chicken(395136) proprotein convertase subtilisin/kexin type 2
dog(485757) proprotein convertase subtilisin/kexin type 2
domestic cat(101098130) proprotein convertase subtilisin/kexin type 2
Horse(100050755) proprotein convertase subtilisin/kexin type 2
cow(281968) proprotein convertase subtilisin/kexin type 2
naked mole-rat(101710029) proprotein convertase subtilisin/kexin type 2
Domestic Rabbit(100358339) proprotein convertase subtilisin/kexin type 2
domestic guinea pig(100727607) proprotein convertase subtilisin/kexin type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1628 Human PCSK2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002351 MISSION® esiRNA esiRNA targeting human PCSK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002594 Rosetta Predictions human pricing
NM_012746 Rosetta Predictions rat pricing
NM_008792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121327 predicted 1956
2 SASI_Hs01_00121328 predicted 597
3 SASI_Hs02_00334098 predicted 1973
4 SASI_Hs01_00121330 predicted 1763
5 SASI_Hs01_00121331 predicted 912
6 SASI_Hs01_00121332 predicted 811
7 SASI_Hs01_00121333 predicted 676
8 SASI_Hs01_00121334 predicted 1841
9 SASI_Hs02_00334099 predicted 745
10 SASI_Hs01_00121335 predicted 977
11 SASI_Hs01_00121326 predicted 651
12 SASI_Hs01_00121329 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106557 predicted 2141
2 SASI_Rn01_00106558 predicted 1087
3 SASI_Rn01_00106559 predicted 1587
4 SASI_Rn01_00106560 predicted 1039
5 SASI_Rn01_00106561 predicted 613
6 SASI_Rn02_00260101 predicted 1132
7 SASI_Rn01_00106563 predicted 649
8 SASI_Rn01_00106564 predicted 617
9 SASI_Rn01_00106566 predicted 856
10 SASI_Rn02_00260102 predicted 870
11 SASI_Rn01_00106562 predicted 1427
12 SASI_Rn01_00106565 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083975 predicted 1032
2 SASI_Mm01_00083976 predicted 1578
3 SASI_Mm01_00083977 predicted 602
4 SASI_Mm01_00083978 predicted 1122
5 SASI_Mm01_00083979 predicted 2188
6 SASI_Mm01_00083980 predicted 1335
7 SASI_Mm01_00083981 predicted 1291
8 SASI_Mm01_00083983 predicted 1565
9 SASI_Mm01_00083984 predicted 588
10 SASI_Mm02_00314692 predicted 685
11 SASI_Mm01_00083982 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002594
PCSK2 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-644s1c1
Sequence:CCGGGCGAGGTTACAGAGACATCAACTCGAGTTGATGTCTCTGTAACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-1049s1c1
Sequence:CCGGGCCATTCATGACAGACATCATCTCGAGATGATGTCTGTCATGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-852s1c1
Sequence:CCGGGCCTCCAACTATAATGCCGAACTCGAGTTCGGCATTATAGTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-507s1c1
Sequence:CCGGGCTGAAGGTCTGTACCACTTTCTCGAGAAAGTGGTACAGACCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-915s1c1
Sequence:CCGGCGGTACACAGATGACTGGTTTCTCGAGAAACCAGTCATCTGTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-817s21c1
Sequence:CCGGTGGATGATGGGATTGACTATCCTCGAGGATAGTCAATCCCATCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002594.2-2703s21c1
Sequence:CCGGAGGAGACACTGTGCTATAAATCTCGAGATTTATAGCACAGTGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-401s21c1
Sequence:CCGGACCGGTCTTCACGAATCATTTCTCGAGAAATGATTCGTGAAGACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002594
PCSK2 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-644s1c1
Sequence:CCGGGCGAGGTTACAGAGACATCAACTCGAGTTGATGTCTCTGTAACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-1049s1c1
Sequence:CCGGGCCATTCATGACAGACATCATCTCGAGATGATGTCTGTCATGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-852s1c1
Sequence:CCGGGCCTCCAACTATAATGCCGAACTCGAGTTCGGCATTATAGTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-507s1c1
Sequence:CCGGGCTGAAGGTCTGTACCACTTTCTCGAGAAAGTGGTACAGACCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-915s1c1
Sequence:CCGGCGGTACACAGATGACTGGTTTCTCGAGAAACCAGTCATCTGTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-817s21c1
Sequence:CCGGTGGATGATGGGATTGACTATCCTCGAGGATAGTCAATCCCATCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002594.2-2703s21c1
Sequence:CCGGAGGAGACACTGTGCTATAAATCTCGAGATTTATAGCACAGTGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-401s21c1
Sequence:CCGGACCGGTCTTCACGAATCATTTCTCGAGAAATGATTCGTGAAGACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002594
PCSK2 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-644s1c1
Sequence:CCGGGCGAGGTTACAGAGACATCAACTCGAGTTGATGTCTCTGTAACCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-1049s1c1
Sequence:CCGGGCCATTCATGACAGACATCATCTCGAGATGATGTCTGTCATGAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-852s1c1
Sequence:CCGGGCCTCCAACTATAATGCCGAACTCGAGTTCGGCATTATAGTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-507s1c1
Sequence:CCGGGCTGAAGGTCTGTACCACTTTCTCGAGAAAGTGGTACAGACCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002594.2-915s1c1
Sequence:CCGGCGGTACACAGATGACTGGTTTCTCGAGAAACCAGTCATCTGTGTACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-817s21c1
Sequence:CCGGTGGATGATGGGATTGACTATCCTCGAGGATAGTCAATCCCATCATCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002594.2-2703s21c1
Sequence:CCGGAGGAGACACTGTGCTATAAATCTCGAGATTTATAGCACAGTGTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002594.2-401s21c1
Sequence:CCGGACCGGTCTTCACGAATCATTTCTCGAGAAATGATTCGTGAAGACCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008792
PCSK2 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-2200s1c1
Sequence:CCGGCCTGCAAAGTATCCTGAGAAACTCGAGTTTCTCAGGATACTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1419s1c1
Sequence:CCGGCAGACTTGTATGGCAACTGTACTCGAGTACAGTTGCCATACAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1615s1c1
Sequence:CCGGCCTGGAATTTAATCACCTCTTCTCGAGAAGAGGTGATTAAATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-842s1c1
Sequence:CCGGGCCTACAACTACAACGCTGATCTCGAGATCAGCGTTGTAGTTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-602s1c1
Sequence:CCGGGCGCTGCAACAAGAAGGATTTCTCGAGAAATCCTTCTTGTTGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008792
PCSK2 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-2200s1c1
Sequence:CCGGCCTGCAAAGTATCCTGAGAAACTCGAGTTTCTCAGGATACTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1419s1c1
Sequence:CCGGCAGACTTGTATGGCAACTGTACTCGAGTACAGTTGCCATACAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1615s1c1
Sequence:CCGGCCTGGAATTTAATCACCTCTTCTCGAGAAGAGGTGATTAAATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-842s1c1
Sequence:CCGGGCCTACAACTACAACGCTGATCTCGAGATCAGCGTTGTAGTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-602s1c1
Sequence:CCGGGCGCTGCAACAAGAAGGATTTCTCGAGAAATCCTTCTTGTTGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008792
PCSK2 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-2200s1c1
Sequence:CCGGCCTGCAAAGTATCCTGAGAAACTCGAGTTTCTCAGGATACTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1419s1c1
Sequence:CCGGCAGACTTGTATGGCAACTGTACTCGAGTACAGTTGCCATACAAGTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-1615s1c1
Sequence:CCGGCCTGGAATTTAATCACCTCTTCTCGAGAAGAGGTGATTAAATTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-842s1c1
Sequence:CCGGGCCTACAACTACAACGCTGATCTCGAGATCAGCGTTGTAGTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008792.3-602s1c1
Sequence:CCGGGCGCTGCAACAAGAAGGATTTCTCGAGAAATCCTTCTTGTTGCAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)