EMAIL THIS PAGE TO A FRIEND

PCSK4

proprotein convertase subtilisin/kexin type 4

49 Gene Product Result for
Synonyms: PC4 SPC5
UniProtKB ID: Q6UW60, Q8IY88, Q9UF79
Gene ID:
Human(54760) Summary: This gene encodes a member of the subtilisin-like proprotein convertase family. These enzymes process latent precursor proteins into their biologically active products. The encoded protein plays a critical role in reproduction and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein (proPACAP) and pro-insulin-like growth factor II. [provided by RefSeq, Feb 2012]
Mouse(18551) proprotein convertase subtilisin/kexin type 4
Rat(171085) proprotein convertase subtilisin/kexin type 4
domestic guinea pig(100735776) proprotein convertase subtilisin/kexin type 4
naked mole-rat(101720174) proprotein convertase subtilisin/kexin type 4
cow(508744) proprotein convertase subtilisin/kexin type 4
sheep(101115707) proprotein convertase subtilisin/kexin type 4
chicken(100859150) proprotein convertase subtilisin/kexin type 4
domestic cat(101097704) proprotein convertase subtilisin/kexin type 4
dog(485083) proprotein convertase subtilisin/kexin type 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017573 Rosetta Predictions human pricing
NM_133559 Rosetta Predictions rat pricing
NM_008793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057253 predicted 589
2 SASI_Hs01_00057254 predicted 1839
3 SASI_Hs01_00057255 predicted 213
4 SASI_Hs01_00057256 predicted 1633
5 SASI_Hs01_00057257 predicted 1460
6 SASI_Hs01_00057258 predicted 1716
7 SASI_Hs01_00057259 predicted 993
8 SASI_Hs01_00057260 predicted 1676
9 SASI_Hs01_00057261 predicted 2239
10 SASI_Hs02_00350228 predicted 212
11 SASI_Hs01_00057262 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114399 predicted 453
2 SASI_Rn01_00114400 predicted 397
3 SASI_Rn01_00114402 predicted 1587
4 SASI_Rn01_00114403 predicted 1673
5 SASI_Rn02_00267752 predicted 289
6 SASI_Rn01_00114404 predicted 1043
7 SASI_Rn01_00114405 predicted 558
8 SASI_Rn01_00114406 predicted 511
9 SASI_Rn02_00267753 predicted 515
10 SASI_Rn01_00114407 predicted 1662
11 SASI_Rn01_00114401 predicted 286
12 SASI_Rn01_00114408 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130122 predicted 1947
2 SASI_Mm01_00130123 predicted 310
3 SASI_Mm01_00130124 predicted 573
4 SASI_Mm01_00130125 predicted 759
5 SASI_Mm02_00314693 predicted 1612
6 SASI_Mm01_00130126 predicted 532
7 SASI_Mm01_00130127 predicted 1626
8 SASI_Mm01_00130128 predicted 1713
9 SASI_Mm01_00130129 predicted 417
10 SASI_Mm02_00314694 predicted 1372
11 SASI_Mm01_00130130 predicted 1285
12 SASI_Mm01_00130131 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008793
PCSK4 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1364s1c1
Sequence:CCGGGCCTCAGAAGAAATGTGCCATCTCGAGATGGCACATTTCTTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1685s1c1
Sequence:CCGGCCTGGAGAATAAGGGCTACTACTCGAGTAGTAGCCCTTATTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-173s1c1
Sequence:CCGGCCGTAAATTTGGCTTCGTCAACTCGAGTTGACGAAGCCAAATTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-282s1c1
Sequence:CCGGCGTCTACGACTGAAGAAAGATCTCGAGATCTTTCTTCAGTCGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-758s1c1
Sequence:CCGGGCCGCAACACATACACATCTACTCGAGTAGATGTGTATGTGTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008793
PCSK4 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1364s1c1
Sequence:CCGGGCCTCAGAAGAAATGTGCCATCTCGAGATGGCACATTTCTTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1685s1c1
Sequence:CCGGCCTGGAGAATAAGGGCTACTACTCGAGTAGTAGCCCTTATTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-173s1c1
Sequence:CCGGCCGTAAATTTGGCTTCGTCAACTCGAGTTGACGAAGCCAAATTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-282s1c1
Sequence:CCGGCGTCTACGACTGAAGAAAGATCTCGAGATCTTTCTTCAGTCGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-758s1c1
Sequence:CCGGGCCGCAACACATACACATCTACTCGAGTAGATGTGTATGTGTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008793
PCSK4 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1364s1c1
Sequence:CCGGGCCTCAGAAGAAATGTGCCATCTCGAGATGGCACATTTCTTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-1685s1c1
Sequence:CCGGCCTGGAGAATAAGGGCTACTACTCGAGTAGTAGCCCTTATTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-173s1c1
Sequence:CCGGCCGTAAATTTGGCTTCGTCAACTCGAGTTGACGAAGCCAAATTTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-282s1c1
Sequence:CCGGCGTCTACGACTGAAGAAAGATCTCGAGATCTTTCTTCAGTCGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008793.1-758s1c1
Sequence:CCGGGCCGCAACACATACACATCTACTCGAGTAGATGTGTATGTGTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017573
PCSK4 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017573.2-1238s1c1
Sequence:CCGGGAGAGAAGTCTCCTCTGCATTCTCGAGAATGCAGAGGAGACTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-397s1c1
Sequence:CCGGAGGCTACAACAACTGGGTCTTCTCGAGAAGACCCAGTTGTTGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-377s1c1
Sequence:CCGGCCCTTGGACGTCAGCACTGAACTCGAGTTCAGTGCTGACGTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-994s1c1
Sequence:CCGGCCTCCCACTATACGCCTGGCTCTCGAGAGCCAGGCGTATAGTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-469s1c1
Sequence:CCGGCCTAGAGAACAAGGGCTACTACTCGAGTAGTAGCCCTTGTTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017573
PCSK4 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017573.2-1238s1c1
Sequence:CCGGGAGAGAAGTCTCCTCTGCATTCTCGAGAATGCAGAGGAGACTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-397s1c1
Sequence:CCGGAGGCTACAACAACTGGGTCTTCTCGAGAAGACCCAGTTGTTGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-377s1c1
Sequence:CCGGCCCTTGGACGTCAGCACTGAACTCGAGTTCAGTGCTGACGTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-994s1c1
Sequence:CCGGCCTCCCACTATACGCCTGGCTCTCGAGAGCCAGGCGTATAGTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-469s1c1
Sequence:CCGGCCTAGAGAACAAGGGCTACTACTCGAGTAGTAGCCCTTGTTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017573
PCSK4 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017573.2-1238s1c1
Sequence:CCGGGAGAGAAGTCTCCTCTGCATTCTCGAGAATGCAGAGGAGACTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-397s1c1
Sequence:CCGGAGGCTACAACAACTGGGTCTTCTCGAGAAGACCCAGTTGTTGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-377s1c1
Sequence:CCGGCCCTTGGACGTCAGCACTGAACTCGAGTTCAGTGCTGACGTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-994s1c1
Sequence:CCGGCCTCCCACTATACGCCTGGCTCTCGAGAGCCAGGCGTATAGTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017573.2-469s1c1
Sequence:CCGGCCTAGAGAACAAGGGCTACTACTCGAGTAGTAGCCCTTGTTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)