EMAIL THIS PAGE TO A FRIEND

PCSK6

proprotein convertase subtilisin/kexin type 6

263 Gene Product Result for
Synonyms: PACE4 SPC4
Gene ID:
Human(5046) Summary: The protein encoded by this gene belongs to the subtilisin-like proprotein convertase family. The members of this family are proprotein convertases that process latent precursor proteins into their biologically active products. This encoded protein is a calcium-dependent serine endoprotease that can cleave precursor protein at their paired basic amino acid processing sites. Some of its substrates are - transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(18553) proprotein convertase subtilisin/kexin type 6
Rat(25507) proprotein convertase subtilisin/kexin type 6
chicken(395454) proprotein convertase subtilisin/kexin type 6
dog(488703) proprotein convertase subtilisin/kexin type 6
Horse(100057677) proprotein convertase subtilisin/kexin type 6
domestic cat(101083941) proprotein convertase subtilisin/kexin type 6
domestic guinea pig(100716755) proprotein convertase subtilisin/kexin type 6
naked mole-rat(101721857) proprotein convertase subtilisin/kexin type 6
Domestic Rabbit(100347173) proprotein convertase subtilisin/kexin type 6
cow(524684) proprotein convertase subtilisin/kexin type 6
sheep(101112091) proprotein convertase subtilisin/kexin type 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_355911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002570 Rosetta Predictions human pricing
NM_138319 Rosetta Predictions human pricing
NM_138320 Rosetta Predictions human pricing
NM_138321 Rosetta Predictions human pricing
NM_138322 Rosetta Predictions human pricing
NM_138323 Rosetta Predictions human pricing
NM_138324 Rosetta Predictions human pricing
NM_138325 Rosetta Predictions human pricing
NM_012999 Rosetta Predictions rat pricing
XM_355911 Rosetta Predictions mouse pricing
XM_886136 Rosetta Predictions mouse pricing
XM_896608 Rosetta Predictions mouse pricing
XM_896616 Rosetta Predictions mouse pricing
XM_905687 Rosetta Predictions mouse pricing
XM_919493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139653 predicted 729
2 SASI_Hs01_00139654 predicted 984
3 SASI_Hs01_00139655 predicted 1279
4 SASI_Hs01_00139656 predicted 917
5 SASI_Hs01_00139657 predicted 1093
6 SASI_Hs01_00139658 predicted 1157
7 SASI_Hs01_00139659 predicted 1094
8 SASI_Hs01_00139660 predicted 1047
9 SASI_Hs01_00139661 predicted 763
10 SASI_Hs01_00139662 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243305 predicted 730
2 SASI_Hs01_00243306 predicted 979
3 SASI_Hs01_00243307 predicted 1278
4 SASI_Hs01_00243308 predicted 910
5 SASI_Hs01_00243309 predicted 1093
6 SASI_Hs01_00243310 predicted 1163
7 SASI_Hs01_00243311 predicted 1098
8 SASI_Hs01_00243312 predicted 1046
9 SASI_Hs01_00243313 predicted 761
10 SASI_Hs01_00243314 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055302 predicted 737
2 SASI_Hs01_00055303 predicted 979
3 SASI_Hs01_00055304 predicted 1287
4 SASI_Hs01_00055305 predicted 917
5 SASI_Hs01_00055306 predicted 1086
6 SASI_Hs01_00055307 predicted 1155
7 SASI_Hs01_00055308 predicted 1092
8 SASI_Hs01_00055309 predicted 1051
9 SASI_Hs01_00055310 predicted 761
10 SASI_Hs01_00055311 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156557 predicted 735
2 SASI_Hs01_00156558 predicted 982
3 SASI_Hs01_00156559 predicted 1287
4 SASI_Hs01_00156560 predicted 910
5 SASI_Hs01_00156561 predicted 1089
6 SASI_Hs01_00156562 predicted 1157
7 SASI_Hs01_00156563 predicted 1095
8 SASI_Hs01_00156564 predicted 1053
9 SASI_Hs01_00156565 predicted 761
10 SASI_Hs01_00156566 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196811 predicted 733
2 SASI_Hs01_00196812 predicted 975
3 SASI_Hs01_00196813 predicted 1279
4 SASI_Hs01_00196814 predicted 913
5 SASI_Hs01_00196815 predicted 1089
6 SASI_Hs01_00196816 predicted 1159
7 SASI_Hs01_00196817 predicted 1092
8 SASI_Hs01_00196818 predicted 1049
9 SASI_Hs01_00196819 predicted 762
10 SASI_Hs01_00196820 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214740 predicted 737
2 SASI_Hs01_00214741 predicted 979
3 SASI_Hs01_00214742 predicted 1279
4 SASI_Hs01_00214743 predicted 913
5 SASI_Hs01_00214744 predicted 1087
6 SASI_Hs01_00214745 predicted 1158
7 SASI_Hs01_00214746 predicted 1094
8 SASI_Hs01_00214747 predicted 1051
9 SASI_Hs01_00214748 predicted 765
10 SASI_Hs01_00214749 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075024 predicted 732
2 SASI_Hs01_00075025 predicted 978
3 SASI_Hs01_00075026 predicted 1286
4 SASI_Hs01_00075027 predicted 915
5 SASI_Hs01_00075028 predicted 1087
6 SASI_Hs01_00075029 predicted 1162
7 SASI_Hs01_00075030 predicted 1100
8 SASI_Hs01_00075031 predicted 1048
9 SASI_Hs01_00075032 predicted 765
10 SASI_Hs01_00075033 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024002 predicted 734
2 SASI_Hs01_00024003 predicted 975
3 SASI_Hs01_00024004 predicted 1284
4 SASI_Hs01_00024005 predicted 910
5 SASI_Hs01_00024006 predicted 1092
6 SASI_Hs01_00024007 predicted 1164
7 SASI_Hs01_00024008 predicted 1092
8 SASI_Hs01_00024009 predicted 1045
9 SASI_Hs01_00024010 predicted 766
10 SASI_Hs01_00024011 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115396 predicted 432
2 SASI_Rn01_00115397 predicted 938
3 SASI_Rn01_00115398 predicted 477
4 SASI_Rn01_00115399 predicted 2059
5 SASI_Rn01_00115400 predicted 660
6 SASI_Rn01_00115401 predicted 1819
7 SASI_Rn01_00115402 predicted 397
8 SASI_Rn01_00115404 predicted 453
9 SASI_Rn02_00260650 predicted 1678
10 SASI_Rn02_00260651 predicted 2299
11 SASI_Rn01_00115403 predicted 1055
12 SASI_Rn01_00115405 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251940 predicted 2581
2 SASI_Mm02_00425883 predicted 502
3 SASI_Mm01_00251941 predicted 2135
4 SASI_Mm01_00251942 predicted 713
5 SASI_Mm01_00251943 predicted 978
6 SASI_Mm01_00251945 predicted 2958
7 SASI_Mm01_00251946 predicted 488
8 SASI_Mm01_00251947 predicted 1206
9 SASI_Mm01_00251949 predicted 2511
10 SASI_Mm02_00425884 predicted 2685
11 SASI_Mm01_00251944 predicted 476
12 SASI_Mm01_00251948 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225702 predicted 2541
2 SASI_Mm02_00428293 predicted 507
3 SASI_Mm01_00225703 predicted 2098
4 SASI_Mm01_00225704 predicted 706
5 SASI_Mm01_00225705 predicted 977
6 SASI_Mm01_00225707 predicted 2924
7 SASI_Mm01_00225708 predicted 488
8 SASI_Mm01_00225709 predicted 1201
9 SASI_Mm01_00225711 predicted 2478
10 SASI_Mm02_00428294 predicted 2640
11 SASI_Mm01_00225706 predicted 470
12 SASI_Mm01_00225710 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273090 predicted 2102
2 SASI_Mm01_00273091 predicted 720
3 SASI_Mm01_00273092 predicted 974
4 SASI_Mm01_00273093 predicted 468
5 SASI_Mm01_00273094 predicted 2921
6 SASI_Mm01_00273095 predicted 487
7 SASI_Mm01_00273096 predicted 1205
8 SASI_Mm01_00273097 predicted 1721
9 SASI_Mm01_00273098 predicted 1556
10 SASI_Mm01_00273099 predicted 2478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280847 predicted 2277
2 SASI_Mm01_00280848 predicted 1822
3 SASI_Mm01_00280849 predicted 438
4 SASI_Mm01_00280850 predicted 709
5 SASI_Mm01_00280851 predicted 2656
6 SASI_Mm01_00280852 predicted 216
7 SASI_Mm01_00280853 predicted 937
8 SASI_Mm01_00280854 predicted 1449
9 SASI_Mm01_00280855 predicted 2200
10 SASI_Mm01_00280856 predicted 2372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431990 predicted 2546
2 SASI_Mm02_00431991 predicted 502
3 SASI_Mm02_00431992 predicted 2098
4 SASI_Mm02_00431993 predicted 708
5 SASI_Mm02_00431994 predicted 974
6 SASI_Mm02_00431995 predicted 2919
7 SASI_Mm02_00431996 predicted 482
8 SASI_Mm02_00431997 predicted 1206
9 SASI_Mm02_00431998 predicted 2471
10 SASI_Mm02_00431999 predicted 2645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442308 predicted 2587
2 SASI_Mm02_00442309 predicted 506
3 SASI_Mm02_00442310 predicted 2139
4 SASI_Mm02_00442311 predicted 714
5 SASI_Mm02_00442312 predicted 970
6 SASI_Mm02_00442313 predicted 2959
7 SASI_Mm02_00442314 predicted 484
8 SASI_Mm02_00442315 predicted 1205
9 SASI_Mm02_00442316 predicted 2510
10 SASI_Mm02_00442317 predicted 2680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002570
VALIDATED
PCSK6 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2111s21c1
Sequence:CCGGAGGGCAGTGGACCTTGGAAATCTCGAGATTTCCAAGGTCCACTGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2339s21c1
Sequence:CCGGGGAAGATTACACAGCTCAATCCTCGAGGATTGAGCTGTGTAATCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-1287s21c1
Sequence:CCGGGCTTTCGAGTATGGCATTAAACTCGAGTTTAATGCCATACTCGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3007s21c1
Sequence:CCGGGTCGAAGGTGTGACGAGAACTCTCGAGAGTTCTCGTCACACCTTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-1717s1c1
Sequence:CCGGCGGGTCATAAAGTTAGCCATTCTCGAGAATGGCTAACTTTATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-1020s1c1
Sequence:CCGGCCACGATATGATGCCAGCAATCTCGAGATTGCTGGCATCATATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-2898s1c1
Sequence:CCGGGAGTGCATTCACTGTGCGAAACTCGAGTTTCGCACAGTGAATGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-2734s1c1
Sequence:CCGGGCGTGGATGAACCTGAGAAATCTCGAGATTTCTCAGGTTCATCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-620s1c1
Sequence:CCGGCCTGGAAGATTACTACCATTTCTCGAGAAATGGTAGTAATCTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3120s21c1
Sequence:CCGGAGCAACGCTGACGAGACATTCCTCGAGGAATGTCTCGTCAGCGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3169s21c1
Sequence:CCGGGCGAACGGAAGCTCTTCATTCCTCGAGGAATGAAGAGCTTCCGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-990s21c1
Sequence:CCGGGACGTGAACGGCAATGATTATCTCGAGATAATCATTGCCGTTCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002570
VALIDATED
PCSK6 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2111s21c1
Sequence:CCGGAGGGCAGTGGACCTTGGAAATCTCGAGATTTCCAAGGTCCACTGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2339s21c1
Sequence:CCGGGGAAGATTACACAGCTCAATCCTCGAGGATTGAGCTGTGTAATCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-1287s21c1
Sequence:CCGGGCTTTCGAGTATGGCATTAAACTCGAGTTTAATGCCATACTCGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3007s21c1
Sequence:CCGGGTCGAAGGTGTGACGAGAACTCTCGAGAGTTCTCGTCACACCTTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-1717s1c1
Sequence:CCGGCGGGTCATAAAGTTAGCCATTCTCGAGAATGGCTAACTTTATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-1020s1c1
Sequence:CCGGCCACGATATGATGCCAGCAATCTCGAGATTGCTGGCATCATATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-2898s1c1
Sequence:CCGGGAGTGCATTCACTGTGCGAAACTCGAGTTTCGCACAGTGAATGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-2734s1c1
Sequence:CCGGGCGTGGATGAACCTGAGAAATCTCGAGATTTCTCAGGTTCATCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-620s1c1
Sequence:CCGGCCTGGAAGATTACTACCATTTCTCGAGAAATGGTAGTAATCTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3120s21c1
Sequence:CCGGAGCAACGCTGACGAGACATTCCTCGAGGAATGTCTCGTCAGCGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3169s21c1
Sequence:CCGGGCGAACGGAAGCTCTTCATTCCTCGAGGAATGAAGAGCTTCCGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-990s21c1
Sequence:CCGGGACGTGAACGGCAATGATTATCTCGAGATAATCATTGCCGTTCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002570
VALIDATED
PCSK6 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2111s21c1
Sequence:CCGGAGGGCAGTGGACCTTGGAAATCTCGAGATTTCCAAGGTCCACTGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-2339s21c1
Sequence:CCGGGGAAGATTACACAGCTCAATCCTCGAGGATTGAGCTGTGTAATCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-1287s21c1
Sequence:CCGGGCTTTCGAGTATGGCATTAAACTCGAGTTTAATGCCATACTCGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3007s21c1
Sequence:CCGGGTCGAAGGTGTGACGAGAACTCTCGAGAGTTCTCGTCACACCTTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-1717s1c1
Sequence:CCGGCGGGTCATAAAGTTAGCCATTCTCGAGAATGGCTAACTTTATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-1020s1c1
Sequence:CCGGCCACGATATGATGCCAGCAATCTCGAGATTGCTGGCATCATATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-2898s1c1
Sequence:CCGGGAGTGCATTCACTGTGCGAAACTCGAGTTTCGCACAGTGAATGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002570.2-2734s1c1
Sequence:CCGGGCGTGGATGAACCTGAGAAATCTCGAGATTTCTCAGGTTCATCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002570.2-620s1c1
Sequence:CCGGCCTGGAAGATTACTACCATTTCTCGAGAAATGGTAGTAATCTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3120s21c1
Sequence:CCGGAGCAACGCTGACGAGACATTCCTCGAGGAATGTCTCGTCAGCGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-3169s21c1
Sequence:CCGGGCGAACGGAAGCTCTTCATTCCTCGAGGAATGAAGAGCTTCCGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002570.3-990s21c1
Sequence:CCGGGACGTGAACGGCAATGATTATCTCGAGATAATCATTGCCGTTCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011048
PCSK6 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2696s21c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2138s21c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-1868s21c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2577s21c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2362s21c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011048
PCSK6 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2696s21c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2138s21c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-1868s21c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2577s21c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2362s21c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011048
PCSK6 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2696s21c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2138s21c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-1868s21c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2577s21c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011048.1-2362s21c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355911
VALIDATED
PCSK6 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-875s1c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-651s1c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-381s1c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-1209s1c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-1090s1c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355911
VALIDATED
PCSK6 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-875s1c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-651s1c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-381s1c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-1209s1c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-1090s1c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355911
VALIDATED
PCSK6 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-875s1c1
Sequence:CCGGCCGGACTTTATGCTGATGAAACTCGAGTTTCATCAGCATAAAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-651s1c1
Sequence:CCGGGTGCTTGAACTGTGTCCACTTCTCGAGAAGTGGACACAGTTCAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-381s1c1
Sequence:CCGGGCTGAAAGAATGGAGCCTCATCTCGAGATGAGGCTCCATTCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355911.1-1209s1c1
Sequence:CCGGGTGTCGAAGATGTGAGGAGAACTCGAGTTCTCCTCACATCTTCGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355911.1-1090s1c1
Sequence:CCGGCCCAGCAGAGAAGAGTGTATTCTCGAGAATACACTCTTCTCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)