EMAIL THIS PAGE TO A FRIEND

PCSK9

proprotein convertase subtilisin/kexin type 9

61 Gene Product Result for
Synonyms: FH3 HCHOLA3 LDLCQ1 NARC-1 NARC1 PC9
UniProtKB ID: Q8NBP7, A8T640, C0JYY9, Q5PSM5, Q5SZQ2
Gene ID:
Human(255738) Summary: This gene encodes a proprotein convertase belonging to the proteinase K subfamily of the secretory subtilase family. The encoded protein is synthesized as a soluble zymogen that undergoes autocatalytic intramolecular processing in the endoplasmic reticulum. The protein may function as a proprotein convertase. This protein plays a role in cholesterol homeostasis and may have a role in the differentiation of cortical neurons. Mutations in this gene have been associated with a third form of autosomal dominant familial hypercholesterolemia (HCHOLA3). [provided by RefSeq, Jul 2008]
Mouse(100102) proprotein convertase subtilisin/kexin type 9
Rat(298296) proprotein convertase subtilisin/kexin type 9
Zebrafish(100150316) proprotein convertase subtilisin/kexin type 9
chicken(424664) proprotein convertase subtilisin/kexin type 9
domestic guinea pig(100731533) proprotein convertase subtilisin/kexin type 9
naked mole-rat(101700911) proprotein convertase subtilisin/kexin type 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174936 siRNAs that have been validated in the lab human pricing
NM_199253 Rosetta Predictions rat pricing
NM_153565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174936 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154293 validated 777
1 SASI_Hs01_00154292 validated 950
1 SASI_Hs01_00154291 validated 1038
2 SASI_Hs01_00154294 predicted 2038
3 SASI_Hs01_00154295 predicted 886
4 SASI_Hs01_00154296 predicted 1522
5 SASI_Hs01_00154298 predicted 1067
6 SASI_Hs01_00154299 predicted 2836
7 SASI_Hs01_00154300 predicted 2308
8 SASI_Hs02_00368873 predicted 2741
9 SASI_Hs01_00154297 predicted 2618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032871 predicted 1241
2 SASI_Rn01_00032874 predicted 1052
3 SASI_Rn01_00032875 predicted 776
4 SASI_Rn02_00270159 predicted 1053
5 SASI_Rn02_00270160 predicted 1248
6 SASI_Rn01_00032876 predicted 1198
7 SASI_Rn01_00032877 predicted 508
8 SASI_Rn01_00032878 predicted 2311
9 SASI_Rn01_00032880 predicted 412
10 SASI_Rn02_00270161 predicted 604
11 SASI_Rn01_00032872 predicted 654
12 SASI_Rn01_00032873 predicted 1774
13 SASI_Rn01_00032879 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020992 predicted 964
2 SASI_Mm01_00020993 predicted 2111
3 SASI_Mm01_00020994 predicted 1224
4 SASI_Mm01_00020995 predicted 745
5 SASI_Mm01_00020996 predicted 1513
6 SASI_Mm01_00020997 predicted 1289
7 SASI_Mm01_00020999 predicted 1214
8 SASI_Mm01_00021000 predicted 2531
9 SASI_Mm01_00021001 predicted 2088
10 SASI_Mm02_00343361 predicted 2535
11 SASI_Mm01_00020998 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153565
PCSK9 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1681s1c1
Sequence:CCGGGCTGATCCACTTCTCTACCAACTCGAGTTGGTAGAGAAGTGGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-977s1c1
Sequence:CCGGGTGGAGGTGTATCTCTTAGATCTCGAGATCTAAGAGATACACCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-698s1c1
Sequence:CCGGCAGAGGCTACAGATTGAACAACTCGAGTTGTTCAATCTGTAGCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1839s1c1
Sequence:CCGGCCACTCGAACAGCTACAGCTACTCGAGTAGCTGTAGCTGTTCGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-2083s1c1
Sequence:CCGGCCATGTCCACTGCCACCAGAACTCGAGTTCTGGTGGCAGTGGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153565
PCSK9 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1681s1c1
Sequence:CCGGGCTGATCCACTTCTCTACCAACTCGAGTTGGTAGAGAAGTGGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-977s1c1
Sequence:CCGGGTGGAGGTGTATCTCTTAGATCTCGAGATCTAAGAGATACACCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-698s1c1
Sequence:CCGGCAGAGGCTACAGATTGAACAACTCGAGTTGTTCAATCTGTAGCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1839s1c1
Sequence:CCGGCCACTCGAACAGCTACAGCTACTCGAGTAGCTGTAGCTGTTCGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-2083s1c1
Sequence:CCGGCCATGTCCACTGCCACCAGAACTCGAGTTCTGGTGGCAGTGGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153565
PCSK9 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1681s1c1
Sequence:CCGGGCTGATCCACTTCTCTACCAACTCGAGTTGGTAGAGAAGTGGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-977s1c1
Sequence:CCGGGTGGAGGTGTATCTCTTAGATCTCGAGATCTAAGAGATACACCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-698s1c1
Sequence:CCGGCAGAGGCTACAGATTGAACAACTCGAGTTGTTCAATCTGTAGCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-1839s1c1
Sequence:CCGGCCACTCGAACAGCTACAGCTACTCGAGTAGCTGTAGCTGTTCGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153565.1-2083s1c1
Sequence:CCGGCCATGTCCACTGCCACCAGAACTCGAGTTCTGGTGGCAGTGGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174936
PCSK9 MISSION shRNA Bacterial Glycerol Stock
proprotein convertase subtilisin/kexin type 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174936.2-2979s1c1
Sequence:CCGGGCCACCTTTACTCTGCTCTATCTCGAGATAGAGCAGAGTAAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2236s1c1
Sequence:CCGGGCCGTAGACAACACGTGTGTACTCGAGTACACACGTGTTGTCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-949s1c1
Sequence:CCGGGCCAGCAAGTGTGACAGTCATCTCGAGATGACTGTCACACTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-1044s1c1
Sequence:CCGGCGTGCTCAACTGCCAAGGGAACTCGAGTTCCCTTGGCAGTTGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2110s1c1
Sequence:CCGGGAATGCAAAGTCAAGGAGCATCTCGAGATGCTCCTTGACTTTGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-1537s21c1
Sequence:CCGGATCCACTTCTCTGCCAAAGATCTCGAGATCTTTGGCAGAGAAGTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-858s21c1
Sequence:CCGGACAGAGTGACCACCGGGAAATCTCGAGATTTCCCGGTGGTCACTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174936.2-2711s21c1
Sequence:CCGGGTTCCGTGCCAGGCATTCAATCTCGAGATTGAATGCCTGGCACGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174936
PCSK9 MISSION shRNA shRNA Plasmid DNA
proprotein convertase subtilisin/kexin type 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174936.2-2979s1c1
Sequence:CCGGGCCACCTTTACTCTGCTCTATCTCGAGATAGAGCAGAGTAAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2236s1c1
Sequence:CCGGGCCGTAGACAACACGTGTGTACTCGAGTACACACGTGTTGTCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-949s1c1
Sequence:CCGGGCCAGCAAGTGTGACAGTCATCTCGAGATGACTGTCACACTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-1044s1c1
Sequence:CCGGCGTGCTCAACTGCCAAGGGAACTCGAGTTCCCTTGGCAGTTGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2110s1c1
Sequence:CCGGGAATGCAAAGTCAAGGAGCATCTCGAGATGCTCCTTGACTTTGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-1537s21c1
Sequence:CCGGATCCACTTCTCTGCCAAAGATCTCGAGATCTTTGGCAGAGAAGTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-858s21c1
Sequence:CCGGACAGAGTGACCACCGGGAAATCTCGAGATTTCCCGGTGGTCACTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174936.2-2711s21c1
Sequence:CCGGGTTCCGTGCCAGGCATTCAATCTCGAGATTGAATGCCTGGCACGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174936
PCSK9 MISSION shRNA Lentiviral Transduction Particles
proprotein convertase subtilisin/kexin type 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174936.2-2979s1c1
Sequence:CCGGGCCACCTTTACTCTGCTCTATCTCGAGATAGAGCAGAGTAAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2236s1c1
Sequence:CCGGGCCGTAGACAACACGTGTGTACTCGAGTACACACGTGTTGTCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-949s1c1
Sequence:CCGGGCCAGCAAGTGTGACAGTCATCTCGAGATGACTGTCACACTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-1044s1c1
Sequence:CCGGCGTGCTCAACTGCCAAGGGAACTCGAGTTCCCTTGGCAGTTGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174936.2-2110s1c1
Sequence:CCGGGAATGCAAAGTCAAGGAGCATCTCGAGATGCTCCTTGACTTTGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-1537s21c1
Sequence:CCGGATCCACTTCTCTGCCAAAGATCTCGAGATCTTTGGCAGAGAAGTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174936.2-858s21c1
Sequence:CCGGACAGAGTGACCACCGGGAAATCTCGAGATTTCCCGGTGGTCACTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174936.2-2711s21c1
Sequence:CCGGGTTCCGTGCCAGGCATTCAATCTCGAGATTGAATGCCTGGCACGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)