EMAIL THIS PAGE TO A FRIEND

PCTP

phosphatidylcholine transfer protein

158 Gene Product Result for
Synonyms: PC-TP STARD2
UniProtKB ID: Q9UKL6, Q9BSC9, Q9UIT3, Q9UKW7
Gene ID:
Mouse(18559) phosphatidylcholine transfer protein
Rat(29510) phosphatidylcholine transfer protein
cow(317656) phosphatidylcholine transfer protein
naked mole-rat(101705722) phosphatidylcholine transfer protein
domestic guinea pig(100724182) phosphatidylcholine transfer protein
Zebrafish(566726) phosphatidylcholine transfer protein
domestic cat(101080337) phosphatidylcholine transfer protein
dog(480563) phosphatidylcholine transfer protein
chicken(417399) phosphatidylcholine transfer protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078911 MISSION® esiRNA esiRNA human PCTP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102402 Rosetta Predictions human pricing
NM_021213 Rosetta Predictions human pricing
NM_017225 Rosetta Predictions rat pricing
NM_008796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323093 predicted 1450
2 SASI_Hs02_00323094 predicted 1056
3 SASI_Hs02_00323095 predicted 782
4 SASI_Hs02_00323096 predicted 1457
5 SASI_Hs02_00323097 predicted 948
6 SASI_Hs02_00323098 predicted 920
7 SASI_Hs02_00323099 predicted 1184
8 SASI_Hs02_00323100 predicted 1240
9 SASI_Hs02_00323101 predicted 814
10 SASI_Hs02_00323102 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354803 predicted 1217
2 SASI_Hs02_00354804 predicted 827
3 SASI_Hs02_00354805 predicted 545
4 SASI_Hs01_00184900 predicted 1217
5 SASI_Hs02_00354806 predicted 711
6 SASI_Hs02_00354807 predicted 688
7 SASI_Hs02_00354808 predicted 956
8 SASI_Hs02_00354809 predicted 1000
9 SASI_Hs02_00354810 predicted 585
10 SASI_Hs01_00184905 predicted 630
11 SASI_Hs01_00184899 predicted 578
12 SASI_Hs01_00184901 predicted 498
13 SASI_Hs01_00184902 predicted 1146
14 SASI_Hs01_00184903 predicted 214
15 SASI_Hs01_00184904 predicted 996
16 SASI_Hs01_00184906 predicted 1067
17 SASI_Hs01_00184907 predicted 557
18 SASI_Hs01_00184908 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050963 predicted 889
2 SASI_Rn01_00050964 predicted 624
3 SASI_Rn02_00261591 predicted 1157
4 SASI_Rn01_00050966 predicted 940
5 SASI_Rn01_00050967 predicted 1138
6 SASI_Rn01_00050968 predicted 853
7 SASI_Rn02_00261592 predicted 298
8 SASI_Rn01_00050969 predicted 229
9 SASI_Rn01_00050970 predicted 497
10 SASI_Rn01_00050971 predicted 1028
11 SASI_Rn01_00050965 predicted 1080
12 SASI_Rn01_00050972 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314701 predicted 664
2 SASI_Mm02_00314702 predicted 626
3 SASI_Mm02_00314703 predicted 871
4 SASI_Mm02_00314704 predicted 958
5 SASI_Mm01_00066646 predicted 604
6 SASI_Mm02_00314705 predicted 626
7 SASI_Mm01_00066653 predicted 249
8 SASI_Mm02_00314706 predicted 592
9 SASI_Mm02_00314707 predicted 661
10 SASI_Mm02_00314708 predicted 856
11 SASI_Mm01_00066644 predicted 311
12 SASI_Mm01_00066645 predicted 341
13 SASI_Mm01_00066647 predicted 467
14 SASI_Mm01_00066648 predicted 499
15 SASI_Mm01_00066649 predicted 292
16 SASI_Mm01_00066650 predicted 220
17 SASI_Mm01_00066651 predicted 424
18 SASI_Mm01_00066652 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021213
VALIDATED
PCTP MISSION shRNA Bacterial Glycerol Stock
phosphatidylcholine transfer protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-462s1c1
Sequence:CCGGGATCCGGGTGAAGCAATACAACTCGAGTTGTATTGCTTCACCCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-337s1c1
Sequence:CCGGCCCATGTCCAACAGAGACTATCTCGAGATAGTCTCTGTTGGACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-588s1c1
Sequence:CCGGCGCCAAGAATGGAGTTCCTAACTCGAGTTAGGAACTCCATTCTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-223s1c1
Sequence:CCGGGACATCTATATGGACTCAGATCTCGAGATCTGAGTCCATATAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-633s1c1
Sequence:CCGGCTGTCAGAACTACCTCAAGAACTCGAGTTCTTGAGGTAGTTCTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-913s1c1
Sequence:CCGGGCCTTCTTCTACAGTTCAATACTCGAGTATTGAACTGTAGAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-357s21c1
Sequence:CCGGAGTATGTTAAAGAACTCTATGCTCGAGCATAGAGTTCTTTAACATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-252s21c1
Sequence:CCGGAGACTGGACTTTATGAGTATACTCGAGTATACTCATAAAGTCCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021213
VALIDATED
PCTP MISSION shRNA shRNA Plasmid DNA
phosphatidylcholine transfer protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-462s1c1
Sequence:CCGGGATCCGGGTGAAGCAATACAACTCGAGTTGTATTGCTTCACCCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-337s1c1
Sequence:CCGGCCCATGTCCAACAGAGACTATCTCGAGATAGTCTCTGTTGGACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-588s1c1
Sequence:CCGGCGCCAAGAATGGAGTTCCTAACTCGAGTTAGGAACTCCATTCTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-223s1c1
Sequence:CCGGGACATCTATATGGACTCAGATCTCGAGATCTGAGTCCATATAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-633s1c1
Sequence:CCGGCTGTCAGAACTACCTCAAGAACTCGAGTTCTTGAGGTAGTTCTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-913s1c1
Sequence:CCGGGCCTTCTTCTACAGTTCAATACTCGAGTATTGAACTGTAGAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-357s21c1
Sequence:CCGGAGTATGTTAAAGAACTCTATGCTCGAGCATAGAGTTCTTTAACATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-252s21c1
Sequence:CCGGAGACTGGACTTTATGAGTATACTCGAGTATACTCATAAAGTCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021213
VALIDATED
PCTP MISSION shRNA Lentiviral Transduction Particles
phosphatidylcholine transfer protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-462s1c1
Sequence:CCGGGATCCGGGTGAAGCAATACAACTCGAGTTGTATTGCTTCACCCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-337s1c1
Sequence:CCGGCCCATGTCCAACAGAGACTATCTCGAGATAGTCTCTGTTGGACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-588s1c1
Sequence:CCGGCGCCAAGAATGGAGTTCCTAACTCGAGTTAGGAACTCCATTCTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-223s1c1
Sequence:CCGGGACATCTATATGGACTCAGATCTCGAGATCTGAGTCCATATAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021213.1-633s1c1
Sequence:CCGGCTGTCAGAACTACCTCAAGAACTCGAGTTCTTGAGGTAGTTCTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_021213.1-913s1c1
Sequence:CCGGGCCTTCTTCTACAGTTCAATACTCGAGTATTGAACTGTAGAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-357s21c1
Sequence:CCGGAGTATGTTAAAGAACTCTATGCTCGAGCATAGAGTTCTTTAACATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021213.2-252s21c1
Sequence:CCGGAGACTGGACTTTATGAGTATACTCGAGTATACTCATAAAGTCCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008796
VALIDATED
PCTP MISSION shRNA Bacterial Glycerol Stock
phosphatidylcholine transfer protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008796.1-595s1c1
Sequence:CCGGCAGCCAAGAATGGAGTTCCAACTCGAGTTGGAACTCCATTCTTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-323s1c1
Sequence:CCGGCTGGGAAGTGAAGTACCCTTTCTCGAGAAAGGGTACTTCACTTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-470s1c1
Sequence:CCGGCATCCGAGTGAAACAGTACAACTCGAGTTGTACTGTTTCACTCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-275s1c1
Sequence:CCGGTGTGAAAGAACTCTACGAGAACTCGAGTTCTCGTAGAGTTCTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-238s1c1
Sequence:CCGGACATGGACTTAGACTACAGAACTCGAGTTCTGTAGTCTAAGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008796
VALIDATED
PCTP MISSION shRNA shRNA Plasmid DNA
phosphatidylcholine transfer protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008796.1-595s1c1
Sequence:CCGGCAGCCAAGAATGGAGTTCCAACTCGAGTTGGAACTCCATTCTTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-323s1c1
Sequence:CCGGCTGGGAAGTGAAGTACCCTTTCTCGAGAAAGGGTACTTCACTTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-470s1c1
Sequence:CCGGCATCCGAGTGAAACAGTACAACTCGAGTTGTACTGTTTCACTCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-275s1c1
Sequence:CCGGTGTGAAAGAACTCTACGAGAACTCGAGTTCTCGTAGAGTTCTTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-238s1c1
Sequence:CCGGACATGGACTTAGACTACAGAACTCGAGTTCTGTAGTCTAAGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008796
VALIDATED
PCTP MISSION shRNA Lentiviral Transduction Particles
phosphatidylcholine transfer protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008796.1-595s1c1
Sequence:CCGGCAGCCAAGAATGGAGTTCCAACTCGAGTTGGAACTCCATTCTTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-323s1c1
Sequence:CCGGCTGGGAAGTGAAGTACCCTTTCTCGAGAAAGGGTACTTCACTTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-470s1c1
Sequence:CCGGCATCCGAGTGAAACAGTACAACTCGAGTTGTACTGTTTCACTCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-275s1c1
Sequence:CCGGTGTGAAAGAACTCTACGAGAACTCGAGTTCTCGTAGAGTTCTTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008796.1-238s1c1
Sequence:CCGGACATGGACTTAGACTACAGAACTCGAGTTCTGTAGTCTAAGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)