EMAIL THIS PAGE TO A FRIEND

PCYOX1

prenylcysteine oxidase 1

68 Gene Product Result for
Synonyms: PCL1
UniProtKB ID: Q9UHG3, B2RB14, O94982, Q8N4N5, Q96QM8
Gene ID:
Human(51449) Summary: Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]
Mouse(66881) prenylcysteine oxidase 1
Rat(246302) prenylcysteine oxidase 1
Zebrafish(550289) prenylcysteine oxidase 1
dog(481418) prenylcysteine oxidase 1
chicken(426297) prenylcysteine oxidase 1
cow(100125835) prenylcysteine oxidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016297 Rosetta Predictions human pricing
NM_145085 Rosetta Predictions rat pricing
NM_025823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032519 predicted 1177
2 SASI_Hs02_00349218 predicted 621
3 SASI_Hs01_00032520 predicted 1264
4 SASI_Hs01_00032521 predicted 457
5 SASI_Hs01_00032522 predicted 909
6 SASI_Hs01_00032523 predicted 865
7 SASI_Hs01_00032524 predicted 1233
8 SASI_Hs01_00032525 predicted 1400
9 SASI_Hs01_00032527 predicted 639
10 SASI_Hs01_00032528 predicted 540
11 SASI_Hs01_00032526 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268660 predicted 835
2 SASI_Rn02_00268661 predicted 320
3 SASI_Rn02_00268662 predicted 928
4 SASI_Rn02_00268663 predicted 433
5 SASI_Rn02_00268664 predicted 998
6 SASI_Rn02_00268665 predicted 1183
7 SASI_Rn02_00268666 predicted 687
8 SASI_Rn02_00268667 predicted 1149
9 SASI_Rn02_00268668 predicted 1531
10 SASI_Rn02_00268669 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168171 predicted 1163
2 SASI_Mm01_00168172 predicted 1029
3 SASI_Mm01_00168173 predicted 729
4 SASI_Mm02_00329080 predicted 194
5 SASI_Mm01_00168176 predicted 528
6 SASI_Mm01_00168178 predicted 1297
7 SASI_Mm01_00168179 predicted 931
8 SASI_Mm01_00168180 predicted 567
9 SASI_Mm02_00329081 predicted 1519
10 SASI_Mm02_00329082 predicted 865
11 SASI_Mm01_00168174 predicted 1342
12 SASI_Mm01_00168175 predicted 1188
13 SASI_Mm01_00168177 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016297
VALIDATED
PCYOX1 MISSION shRNA Bacterial Glycerol Stock
prenylcysteine oxidase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-656s1c1
Sequence:CCGGGCTCCTGTTATGAGGGTCAATCTCGAGATTGACCCTCATAACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-116s1c1
Sequence:CCGGGCGATTATTGGAGCCGGAATTCTCGAGAATTCCGGCTCCAATAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-1303s1c1
Sequence:CCGGGCTTGCATATCCTCACTATAACTCGAGTTATAGTGAGGATATGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-1340s1c1
Sequence:CCGGCCCTCTATCATTCTCCATGATCTCGAGATCATGGAGAATGATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-852s1c1
Sequence:CCGGCCAAGTACACAGGAAATCCAACTCGAGTTGGATTTCCTGTGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-721s21c1
Sequence:CCGGCCTGTTATGAGGGTCAATTATCTCGAGATAATTGACCCTCATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-1137s21c1
Sequence:CCGGTAGCTCTAGACCCATAGATAACTCGAGTTATCTATGGGTCTAGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-464s21c1
Sequence:CCGGGGTTCATAATTAACGTGATTACTCGAGTAATCACGTTAATTATGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016297.3-4828s21c1
Sequence:CCGGAGTCAATGAAGGAGTTATAAACTCGAGTTTATAACTCCTTCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-202s21c1
Sequence:CCGGGGCACTTCAGCAGCCTATTACCTCGAGGTAATAGGCTGCTGAAGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016297
VALIDATED
PCYOX1 MISSION shRNA shRNA Plasmid DNA
prenylcysteine oxidase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-656s1c1
Sequence:CCGGGCTCCTGTTATGAGGGTCAATCTCGAGATTGACCCTCATAACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-116s1c1
Sequence:CCGGGCGATTATTGGAGCCGGAATTCTCGAGAATTCCGGCTCCAATAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-1303s1c1
Sequence:CCGGGCTTGCATATCCTCACTATAACTCGAGTTATAGTGAGGATATGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-1340s1c1
Sequence:CCGGCCCTCTATCATTCTCCATGATCTCGAGATCATGGAGAATGATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-852s1c1
Sequence:CCGGCCAAGTACACAGGAAATCCAACTCGAGTTGGATTTCCTGTGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-721s21c1
Sequence:CCGGCCTGTTATGAGGGTCAATTATCTCGAGATAATTGACCCTCATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-1137s21c1
Sequence:CCGGTAGCTCTAGACCCATAGATAACTCGAGTTATCTATGGGTCTAGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-464s21c1
Sequence:CCGGGGTTCATAATTAACGTGATTACTCGAGTAATCACGTTAATTATGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016297.3-4828s21c1
Sequence:CCGGAGTCAATGAAGGAGTTATAAACTCGAGTTTATAACTCCTTCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-202s21c1
Sequence:CCGGGGCACTTCAGCAGCCTATTACCTCGAGGTAATAGGCTGCTGAAGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016297
VALIDATED
PCYOX1 MISSION shRNA Lentiviral Transduction Particles
prenylcysteine oxidase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-656s1c1
Sequence:CCGGGCTCCTGTTATGAGGGTCAATCTCGAGATTGACCCTCATAACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-116s1c1
Sequence:CCGGGCGATTATTGGAGCCGGAATTCTCGAGAATTCCGGCTCCAATAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-1303s1c1
Sequence:CCGGGCTTGCATATCCTCACTATAACTCGAGTTATAGTGAGGATATGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016297.2-1340s1c1
Sequence:CCGGCCCTCTATCATTCTCCATGATCTCGAGATCATGGAGAATGATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016297.2-852s1c1
Sequence:CCGGCCAAGTACACAGGAAATCCAACTCGAGTTGGATTTCCTGTGTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-721s21c1
Sequence:CCGGCCTGTTATGAGGGTCAATTATCTCGAGATAATTGACCCTCATAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-1137s21c1
Sequence:CCGGTAGCTCTAGACCCATAGATAACTCGAGTTATCTATGGGTCTAGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-464s21c1
Sequence:CCGGGGTTCATAATTAACGTGATTACTCGAGTAATCACGTTAATTATGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016297.3-4828s21c1
Sequence:CCGGAGTCAATGAAGGAGTTATAAACTCGAGTTTATAACTCCTTCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016297.3-202s21c1
Sequence:CCGGGGCACTTCAGCAGCCTATTACCTCGAGGTAATAGGCTGCTGAAGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025823
PCYOX1 MISSION shRNA Bacterial Glycerol Stock
prenylcysteine oxidase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025823.3-2289s1c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1001s1c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-855s1c1
Sequence:CCGGCGTAATGTCAATAGAGGAGAACTCGAGTTCTCCTCTATTGACATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1296s1c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-183s1c1
Sequence:CCGGCGCCTATTATCTAAGGAAGAACTCGAGTTCTTCCTTAGATAATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1326s21c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1031s21c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-245s21c1
Sequence:CCGGACGTGAAGATTGACGTGTTTGCTCGAGCAAACACGTCAATCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-719s21c1
Sequence:CCGGCTCCTGTCATGAAGGTCAATTCTCGAGAATTGACCTTCATGACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025823.4-2319s21c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025823
PCYOX1 MISSION shRNA shRNA Plasmid DNA
prenylcysteine oxidase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025823.3-2289s1c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1001s1c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-855s1c1
Sequence:CCGGCGTAATGTCAATAGAGGAGAACTCGAGTTCTCCTCTATTGACATTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1296s1c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-183s1c1
Sequence:CCGGCGCCTATTATCTAAGGAAGAACTCGAGTTCTTCCTTAGATAATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1326s21c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1031s21c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-245s21c1
Sequence:CCGGACGTGAAGATTGACGTGTTTGCTCGAGCAAACACGTCAATCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-719s21c1
Sequence:CCGGCTCCTGTCATGAAGGTCAATTCTCGAGAATTGACCTTCATGACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025823.4-2319s21c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025823
PCYOX1 MISSION shRNA Lentiviral Transduction Particles
prenylcysteine oxidase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025823.3-2289s1c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1001s1c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-855s1c1
Sequence:CCGGCGTAATGTCAATAGAGGAGAACTCGAGTTCTCCTCTATTGACATTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-1296s1c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025823.3-183s1c1
Sequence:CCGGCGCCTATTATCTAAGGAAGAACTCGAGTTCTTCCTTAGATAATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1326s21c1
Sequence:CCGGGCTCTTCCTGTCCTATGATTACTCGAGTAATCATAGGACAGGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-1031s21c1
Sequence:CCGGCCAACATAACTTTCCGAAATTCTCGAGAATTTCGGAAAGTTATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-245s21c1
Sequence:CCGGACGTGAAGATTGACGTGTTTGCTCGAGCAAACACGTCAATCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025823.4-719s21c1
Sequence:CCGGCTCCTGTCATGAAGGTCAATTCTCGAGAATTGACCTTCATGACAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025823.4-2319s21c1
Sequence:CCGGCGGCTTTATCAGGGATAGATTCTCGAGAATCTATCCCTGATAAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)