EMAIL THIS PAGE TO A FRIEND

PCYT1A

phosphate cytidylyltransferase 1, choline, alpha

65 Gene Product Result for
Synonyms: CCTA CT CTA CTPCT PCYT1
UniProtKB ID: P49585, A9LYK9, D3DXB1, Q86Y88
Gene ID:
Mouse(13026) phosphate cytidylyltransferase 1, choline, alpha isoform
Rat(140544) phosphate cytidylyltransferase 1, choline, alpha
chicken(424915) phosphate cytidylyltransferase 1, choline, alpha
Horse(100060318) phosphate cytidylyltransferase 1, choline, alpha
domestic cat(101099320) phosphate cytidylyltransferase 1, choline, alpha
dog(478600) phosphate cytidylyltransferase 1, choline, alpha
cow(100125779) phosphate cytidylyltransferase 1, choline, alpha
sheep(101120976) phosphate cytidylyltransferase 1, choline, alpha
naked mole-rat(101705565) phosphate cytidylyltransferase 1, choline, alpha
domestic guinea pig(100715350) phosphate cytidylyltransferase 1, choline, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005017 Rosetta Predictions human pricing
NM_078622 Rosetta Predictions rat pricing
NM_009981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127877 predicted 789
2 SASI_Hs01_00127878 predicted 339
3 SASI_Hs01_00127879 predicted 552
4 SASI_Hs01_00127880 predicted 1240
5 SASI_Hs02_00338788 predicted 863
6 SASI_Hs01_00127882 predicted 1015
7 SASI_Hs02_00338789 predicted 1007
8 SASI_Hs01_00127884 predicted 313
9 SASI_Hs01_00127885 predicted 760
10 SASI_Hs01_00127886 predicted 761
11 SASI_Hs01_00127881 predicted 1015
12 SASI_Hs01_00127883 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108197 predicted 340
2 SASI_Rn01_00108198 predicted 582
3 SASI_Rn01_00108199 predicted 1190
4 SASI_Rn02_00267201 predicted 1288
5 SASI_Rn01_00108200 predicted 326
6 SASI_Rn01_00108201 predicted 269
7 SASI_Rn01_00108202 predicted 816
8 SASI_Rn01_00108203 predicted 490
9 SASI_Rn01_00108204 predicted 730
10 SASI_Rn01_00108205 predicted 279
11 SASI_Rn01_00108196 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063354 predicted 363
2 SASI_Mm01_00063355 predicted 349
3 SASI_Mm01_00063356 predicted 1126
4 SASI_Mm01_00063357 predicted 891
5 SASI_Mm01_00063358 predicted 763
6 SASI_Mm02_00317574 predicted 276
7 SASI_Mm02_00317575 predicted 386
8 SASI_Mm01_00063359 predicted 914
9 SASI_Mm01_00063360 predicted 633
10 SASI_Mm01_00063361 predicted 282
11 SASI_Mm01_00063362 predicted 752
12 SASI_Mm01_00063363 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009981
VALIDATED
PCYT1A MISSION shRNA Bacterial Glycerol Stock
phosphate cytidylyltransferase 1, choline, alpha
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-293s21c1
Sequence:CCGGCCCTATGTCAGGGTGACTATGCTCGAGCATAGTCACCCTGACATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009981.2-203s1c1
Sequence:CCGGGTTGACTTTAGTAAGCCCTATCTCGAGATAGGGCTTACTAAAGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-579s1c1
Sequence:CCGGGCGATGATGTGTATAAGCACACTCGAGTGTGCTTATACACATCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-891s1c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-492s21c1
Sequence:CCGGTCACTGTGATGAACGAGAATGCTCGAGCATTCTCGTTCATCACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.3-1398s21c1
Sequence:CCGGTACTGTTTATGCTCATGTAATCTCGAGATTACATGAGCATAAACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-891s21c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-272s1c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-1238s1c1
Sequence:CCGGCCTAAGGACATCTACAAAGAACTCGAGTTCTTTGTAGATGTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.4-1488s21c1
Sequence:CCGGTGTAATCTTGACAGGGAAATTCTCGAGAATTTCCCTGTCAAGATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-272s21c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-520s21c1
Sequence:CCGGGGCAGAGCACCGGATTGATTTCTCGAGAAATCAATCCGGTGCTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-352s21c1
Sequence:CCGGTTTCCCTAATACGTATCTAATCTCGAGATTAGATACGTATTAGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009981
VALIDATED
PCYT1A MISSION shRNA shRNA Plasmid DNA
phosphate cytidylyltransferase 1, choline, alpha
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-293s21c1
Sequence:CCGGCCCTATGTCAGGGTGACTATGCTCGAGCATAGTCACCCTGACATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009981.2-203s1c1
Sequence:CCGGGTTGACTTTAGTAAGCCCTATCTCGAGATAGGGCTTACTAAAGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-579s1c1
Sequence:CCGGGCGATGATGTGTATAAGCACACTCGAGTGTGCTTATACACATCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-891s1c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-492s21c1
Sequence:CCGGTCACTGTGATGAACGAGAATGCTCGAGCATTCTCGTTCATCACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.3-1398s21c1
Sequence:CCGGTACTGTTTATGCTCATGTAATCTCGAGATTACATGAGCATAAACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-891s21c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-272s1c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-1238s1c1
Sequence:CCGGCCTAAGGACATCTACAAAGAACTCGAGTTCTTTGTAGATGTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.4-1488s21c1
Sequence:CCGGTGTAATCTTGACAGGGAAATTCTCGAGAATTTCCCTGTCAAGATTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-272s21c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-520s21c1
Sequence:CCGGGGCAGAGCACCGGATTGATTTCTCGAGAAATCAATCCGGTGCTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-352s21c1
Sequence:CCGGTTTCCCTAATACGTATCTAATCTCGAGATTAGATACGTATTAGGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009981
VALIDATED
PCYT1A MISSION shRNA Lentiviral Transduction Particles
phosphate cytidylyltransferase 1, choline, alpha
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-293s21c1
Sequence:CCGGCCCTATGTCAGGGTGACTATGCTCGAGCATAGTCACCCTGACATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009981.2-203s1c1
Sequence:CCGGGTTGACTTTAGTAAGCCCTATCTCGAGATAGGGCTTACTAAAGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-579s1c1
Sequence:CCGGGCGATGATGTGTATAAGCACACTCGAGTGTGCTTATACACATCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-891s1c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.4-492s21c1
Sequence:CCGGTCACTGTGATGAACGAGAATGCTCGAGCATTCTCGTTCATCACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.3-1398s21c1
Sequence:CCGGTACTGTTTATGCTCATGTAATCTCGAGATTACATGAGCATAAACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-891s21c1
Sequence:CCGGCCCGAGAGTTCATTGGAAGTTCTCGAGAACTTCCAATGAACTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-272s1c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009981.2-1238s1c1
Sequence:CCGGCCTAAGGACATCTACAAAGAACTCGAGTTCTTTGTAGATGTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009981.4-1488s21c1
Sequence:CCGGTGTAATCTTGACAGGGAAATTCTCGAGAATTTCCCTGTCAAGATTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-272s21c1
Sequence:CCGGCCTGTGAGAGTTTATGCGGATCTCGAGATCCGCATAAACTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-520s21c1
Sequence:CCGGGGCAGAGCACCGGATTGATTTCTCGAGAAATCAATCCGGTGCTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009981.3-352s21c1
Sequence:CCGGTTTCCCTAATACGTATCTAATCTCGAGATTAGATACGTATTAGGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005017
VALIDATED
PCYT1A MISSION shRNA Bacterial Glycerol Stock
phosphate cytidylyltransferase 1, choline, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1019s1c1
Sequence:CCGGCCGAGAATTCATTGGAAGTTTCTCGAGAAACTTCCAATGAATTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1303s1c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-344s1c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-672s1c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-490s1c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-344s21c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005017.2-1303s21c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-672s21c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-490s21c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005017
VALIDATED
PCYT1A MISSION shRNA shRNA Plasmid DNA
phosphate cytidylyltransferase 1, choline, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1019s1c1
Sequence:CCGGCCGAGAATTCATTGGAAGTTTCTCGAGAAACTTCCAATGAATTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1303s1c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-344s1c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-672s1c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-490s1c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-344s21c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005017.2-1303s21c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-672s21c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-490s21c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005017
VALIDATED
PCYT1A MISSION shRNA Lentiviral Transduction Particles
phosphate cytidylyltransferase 1, choline, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1019s1c1
Sequence:CCGGCCGAGAATTCATTGGAAGTTTCTCGAGAAACTTCCAATGAATTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005017.2-1303s1c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-344s1c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-672s1c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005017.2-490s1c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-344s21c1
Sequence:CCGGGCCCTATGTCAGGGTAACTATCTCGAGATAGTTACCCTGACATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005017.2-1303s21c1
Sequence:CCGGCCCTTTCTGTCCCATTACCTTCTCGAGAAGGTAATGGGACAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-672s21c1
Sequence:CCGGGCCCATGATGATATTCCTTATCTCGAGATAAGGAATATCATCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005017.2-490s21c1
Sequence:CCGGCGTACCTCATTGTGGGAGTTTCTCGAGAAACTCCCACAATGAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)