EMAIL THIS PAGE TO A FRIEND

PDAP1

PDGFA associated protein 1

119 Gene Product Result for
Synonyms: HASPP28 PAP PAP1
UniProtKB ID: Q13442, D6W5S5, Q92906
Gene ID:
Human(11333) Summary: The protein encoded by this gene is a phosphoprotein that may upregulate the PDGFA-stimulated growth of fibroblasts and also downregulate the mitogenicity of PDGFB. The encoded protein in rodents has been shown to bind PDGFA with a low affinity. [provided by RefSeq, Dec 2010]
Mouse(231887) PDGFA associated protein 1
Rat(64527) PDGFA associated protein 1
chicken(416491) PDGFA associated protein 1
domestic cat(101084923) PDGFA associated protein 1
dog(489861) PDGFA associated protein 1
cow(100139074) PDGFA associated protein 1
sheep(101102867) PDGFA associated protein 1
domestic guinea pig(100722991) PDGFA associated protein 1
naked mole-rat(101725220) PDGFA associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108831 MISSION® esiRNA esiRNA human PDAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014891 Rosetta Predictions human pricing
NM_022595 Rosetta Predictions rat pricing
NM_001033313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148785 predicted 347
2 SASI_Hs01_00148786 predicted 354
3 SASI_Hs01_00148787 predicted 1072
4 SASI_Hs01_00148788 predicted 509
5 SASI_Hs01_00148789 predicted 317
6 SASI_Hs01_00148790 predicted 444
7 SASI_Hs01_00148791 predicted 639
8 SASI_Hs01_00148792 predicted 498
9 SASI_Hs01_00148793 predicted 171
10 SASI_Hs01_00148794 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051574 predicted 972
2 SASI_Rn01_00051575 predicted 257
3 SASI_Rn01_00051576 predicted 216
4 SASI_Rn01_00051577 predicted 305
5 SASI_Rn01_00051578 predicted 295
6 SASI_Rn01_00051579 predicted 251
7 SASI_Rn01_00051580 predicted 301
8 SASI_Rn01_00051581 predicted 974
9 SASI_Rn01_00051582 predicted 323
10 SASI_Rn01_00051583 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193340 predicted 299
2 SASI_Mm01_00193341 predicted 1107
3 SASI_Mm01_00193342 predicted 474
4 SASI_Mm01_00193343 predicted 1095
5 SASI_Mm01_00193344 predicted 1094
6 SASI_Mm02_00288518 predicted 389
7 SASI_Mm01_00193345 predicted 1138
8 SASI_Mm01_00193347 predicted 378
9 SASI_Mm02_00288519 predicted 202
10 SASI_Mm02_00288520 predicted 1056
11 SASI_Mm01_00193346 predicted 1061
12 SASI_Mm01_00193348 predicted 1062
13 SASI_Mm01_00193349 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014891
VALIDATED
PDAP1 MISSION shRNA Bacterial Glycerol Stock
PDGFA associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-861s21c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-616s21c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-440s21c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014891.5-643s21c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-643s1c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-281s1c1
Sequence:CCGGGAGAAGAAATCTCTAGACTCACTCGAGTGAGTCTAGAGATTTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014891.5-861s1c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-616s1c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-440s1c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014891
VALIDATED
PDAP1 MISSION shRNA shRNA Plasmid DNA
PDGFA associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-861s21c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-616s21c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-440s21c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014891.5-643s21c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-643s1c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-281s1c1
Sequence:CCGGGAGAAGAAATCTCTAGACTCACTCGAGTGAGTCTAGAGATTTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014891.5-861s1c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-616s1c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-440s1c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014891
VALIDATED
PDAP1 MISSION shRNA Lentiviral Transduction Particles
PDGFA associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-861s21c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-616s21c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014891.5-440s21c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014891.5-643s21c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-643s1c1
Sequence:CCGGGCAGTCACTCTCCCTGAATAACTCGAGTTATTCAGGGAGAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-281s1c1
Sequence:CCGGGAGAAGAAATCTCTAGACTCACTCGAGTGAGTCTAGAGATTTCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014891.5-861s1c1
Sequence:CCGGGCTGCTATCTTTGAGACAGAACTCGAGTTCTGTCTCAAAGATAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-616s1c1
Sequence:CCGGCGATGCCACATTGTCAGGAAACTCGAGTTTCCTGACAATGTGGCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014891.5-440s1c1
Sequence:CCGGCTTTCGAGGAGAGAACGAGAACTCGAGTTCTCGTTCTCTCCTCGAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033313
VALIDATED
PDAP1 MISSION shRNA Bacterial Glycerol Stock
PDGFA associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-1301s21c1
Sequence:CCGGTTAAACGACAACATCGTAATTCTCGAGAATTACGATGTTGTCGTTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-632s21c1
Sequence:CCGGGCAGTCGCTGTCCCTGAATAACTCGAGTTATTCAGGGACAGCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-278s21c1
Sequence:CCGGATCTCTAGACTCAGATGAAAGCTCGAGCTTTCATCTGAGTCTAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-476s21c1
Sequence:CCGGACGCTACATGAAGATGCATTTCTCGAGAAATGCATCTTCATGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-537s21c1
Sequence:CCGGCTGGCAATCATCCGGAAACAGCTCGAGCTGTTTCCGGATGATTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033313
VALIDATED
PDAP1 MISSION shRNA shRNA Plasmid DNA
PDGFA associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-1301s21c1
Sequence:CCGGTTAAACGACAACATCGTAATTCTCGAGAATTACGATGTTGTCGTTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-632s21c1
Sequence:CCGGGCAGTCGCTGTCCCTGAATAACTCGAGTTATTCAGGGACAGCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-278s21c1
Sequence:CCGGATCTCTAGACTCAGATGAAAGCTCGAGCTTTCATCTGAGTCTAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-476s21c1
Sequence:CCGGACGCTACATGAAGATGCATTTCTCGAGAAATGCATCTTCATGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-537s21c1
Sequence:CCGGCTGGCAATCATCCGGAAACAGCTCGAGCTGTTTCCGGATGATTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033313
VALIDATED
PDAP1 MISSION shRNA Lentiviral Transduction Particles
PDGFA associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-1301s21c1
Sequence:CCGGTTAAACGACAACATCGTAATTCTCGAGAATTACGATGTTGTCGTTTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-632s21c1
Sequence:CCGGGCAGTCGCTGTCCCTGAATAACTCGAGTTATTCAGGGACAGCGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-278s21c1
Sequence:CCGGATCTCTAGACTCAGATGAAAGCTCGAGCTTTCATCTGAGTCTAGAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-476s21c1
Sequence:CCGGACGCTACATGAAGATGCATTTCTCGAGAAATGCATCTTCATGTAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033313.3-537s21c1
Sequence:CCGGCTGGCAATCATCCGGAAACAGCTCGAGCTGTTTCCGGATGATTGCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)