EMAIL THIS PAGE TO A FRIEND

PDC

phosducin

63 Gene Product Result for
Synonyms: MEKA PHD PhLOP PhLP
UniProtKB ID: P20941, Q14816, Q9UP22
Gene ID:
Human(5132) Summary: This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(20028) phosducin
Rat(25343) phosducin
chicken(429078) phosducin
Horse(100033898) phosducin
dog(403624) phosducin
cow(287007) phosducin
sheep(101110954) phosducin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005701 MISSION® esiRNA esiRNA targeting mouse Pdc (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002597 Rosetta Predictions human pricing
NM_022576 Rosetta Predictions human pricing
NM_012872 Rosetta Predictions rat pricing
NM_024458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070572 predicted 897
2 SASI_Hs01_00070573 predicted 860
3 SASI_Hs01_00070574 predicted 480
4 SASI_Hs01_00070576 predicted 550
5 SASI_Hs01_00070577 predicted 827
6 SASI_Hs01_00070578 predicted 395
7 SASI_Hs01_00070579 predicted 759
8 SASI_Hs01_00070580 predicted 411
9 SASI_Hs02_00334102 predicted 611
10 SASI_Hs02_00334103 predicted 879
11 SASI_Hs01_00070575 predicted 472
12 SASI_Hs01_00070581 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166597 predicted 851
2 SASI_Hs01_00166598 predicted 830
3 SASI_Hs01_00166599 predicted 447
4 SASI_Hs01_00166601 predicted 510
5 SASI_Hs01_00166602 predicted 797
6 SASI_Hs01_00166603 predicted 352
7 SASI_Hs01_00166604 predicted 723
8 SASI_Hs01_00166605 predicted 373
9 SASI_Hs02_00355880 predicted 573
10 SASI_Hs02_00355881 predicted 847
11 SASI_Hs01_00166600 predicted 442
12 SASI_Hs01_00166606 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114139 predicted 637
2 SASI_Rn01_00114140 predicted 523
3 SASI_Rn01_00114141 predicted 287
4 SASI_Rn01_00114142 predicted 554
5 SASI_Rn01_00114143 predicted 843
6 SASI_Rn01_00114144 predicted 405
7 SASI_Rn01_00114145 predicted 693
8 SASI_Rn01_00114146 predicted 394
9 SASI_Rn01_00114147 predicted 877
10 SASI_Rn01_00114148 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109396 predicted 503
2 SASI_Mm01_00109397 predicted 318
3 SASI_Mm01_00109398 predicted 394
4 SASI_Mm01_00109400 predicted 213
5 SASI_Mm01_00109401 predicted 314
6 SASI_Mm01_00109402 predicted 309
7 SASI_Mm01_00109403 predicted 511
8 SASI_Mm01_00109404 predicted 661
9 SASI_Mm02_00327813 predicted 578
10 SASI_Mm01_00109405 predicted 318
11 SASI_Mm01_00109399 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002597
PDC MISSION shRNA Bacterial Glycerol Stock
phosducin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-397s1c1
Sequence:CCGGGCCTAGATATGGGTTTGTGTACTCGAGTACACAAACCCATATCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-686s1c1
Sequence:CCGGGCTGAACAGTTTGCTGAAGAACTCGAGTTCTTCAGCAAACTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-500s1c1
Sequence:CCGGGATGGTATTAAGGGTTGTGATCTCGAGATCACAACCCTTAATACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-132s1c1
Sequence:CCGGCAGGACCCAAAGGAGTAATAACTCGAGTTATTACTCCTTTGGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-200s1c1
Sequence:CCGGCCACCTAGCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGCTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002597.3-837s21c1
Sequence:CCGGATGTTTATCCTTTAGGTATTGCTCGAGCAATACCTAAAGGATAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002597.3-632s21c1
Sequence:CCGGCCTACACTGCTCATCTATAAACTCGAGTTTATAGATGAGCAGTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002597
PDC MISSION shRNA shRNA Plasmid DNA
phosducin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-397s1c1
Sequence:CCGGGCCTAGATATGGGTTTGTGTACTCGAGTACACAAACCCATATCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-686s1c1
Sequence:CCGGGCTGAACAGTTTGCTGAAGAACTCGAGTTCTTCAGCAAACTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-500s1c1
Sequence:CCGGGATGGTATTAAGGGTTGTGATCTCGAGATCACAACCCTTAATACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-132s1c1
Sequence:CCGGCAGGACCCAAAGGAGTAATAACTCGAGTTATTACTCCTTTGGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-200s1c1
Sequence:CCGGCCACCTAGCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGCTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002597.3-837s21c1
Sequence:CCGGATGTTTATCCTTTAGGTATTGCTCGAGCAATACCTAAAGGATAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002597.3-632s21c1
Sequence:CCGGCCTACACTGCTCATCTATAAACTCGAGTTTATAGATGAGCAGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002597
PDC MISSION shRNA Lentiviral Transduction Particles
phosducin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-397s1c1
Sequence:CCGGGCCTAGATATGGGTTTGTGTACTCGAGTACACAAACCCATATCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-686s1c1
Sequence:CCGGGCTGAACAGTTTGCTGAAGAACTCGAGTTCTTCAGCAAACTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-500s1c1
Sequence:CCGGGATGGTATTAAGGGTTGTGATCTCGAGATCACAACCCTTAATACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-132s1c1
Sequence:CCGGCAGGACCCAAAGGAGTAATAACTCGAGTTATTACTCCTTTGGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002597.3-200s1c1
Sequence:CCGGCCACCTAGCAAGAAGGAGATTCTCGAGAATCTCCTTCTTGCTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002597.3-837s21c1
Sequence:CCGGATGTTTATCCTTTAGGTATTGCTCGAGCAATACCTAAAGGATAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002597.3-632s21c1
Sequence:CCGGCCTACACTGCTCATCTATAAACTCGAGTTTATAGATGAGCAGTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024458
PDC MISSION shRNA Bacterial Glycerol Stock
phosducin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-595s1c1
Sequence:CCGGCCCAATGGTCAAGTTCTGTAACTCGAGTTACAGAACTTGACCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-433s1c1
Sequence:CCGGGCCTAGGTATGGGTTTGTGTACTCGAGTACACAAACCCATACCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-668s1c1
Sequence:CCGGCCTACGTTGCTGGTGTACAAACTCGAGTTTGTACACCAGCAACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-179s1c1
Sequence:CCGGCCCAAAGGAGTAATAAATGATCTCGAGATCATTTATTACTCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-776s1c1
Sequence:CCGGGAATATGGATTACTACCAGAACTCGAGTTCTGGTAGTAATCCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024458
PDC MISSION shRNA shRNA Plasmid DNA
phosducin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-595s1c1
Sequence:CCGGCCCAATGGTCAAGTTCTGTAACTCGAGTTACAGAACTTGACCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-433s1c1
Sequence:CCGGGCCTAGGTATGGGTTTGTGTACTCGAGTACACAAACCCATACCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-668s1c1
Sequence:CCGGCCTACGTTGCTGGTGTACAAACTCGAGTTTGTACACCAGCAACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-179s1c1
Sequence:CCGGCCCAAAGGAGTAATAAATGATCTCGAGATCATTTATTACTCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-776s1c1
Sequence:CCGGGAATATGGATTACTACCAGAACTCGAGTTCTGGTAGTAATCCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024458
PDC MISSION shRNA Lentiviral Transduction Particles
phosducin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-595s1c1
Sequence:CCGGCCCAATGGTCAAGTTCTGTAACTCGAGTTACAGAACTTGACCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-433s1c1
Sequence:CCGGGCCTAGGTATGGGTTTGTGTACTCGAGTACACAAACCCATACCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-668s1c1
Sequence:CCGGCCTACGTTGCTGGTGTACAAACTCGAGTTTGTACACCAGCAACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-179s1c1
Sequence:CCGGCCCAAAGGAGTAATAAATGATCTCGAGATCATTTATTACTCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024458.1-776s1c1
Sequence:CCGGGAATATGGATTACTACCAGAACTCGAGTTCTGGTAGTAATCCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)