EMAIL THIS PAGE TO A FRIEND

PDCD2

programmed cell death 2

82 Gene Product Result for
Synonyms: RP8 ZMYND7
UniProtKB ID: Q16342, Q58HM9, Q58HN0, Q9UH12
Gene ID:
Human(5134) Summary: This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]
Mouse(18567) programmed cell death 2
Rat(58934) programmed cell death 2
Zebrafish(393370) programmed cell death 2
domestic cat(101084453) programmed cell death 2
dog(475041) programmed cell death 2
chicken(421550) programmed cell death 2
cow(512079) programmed cell death 2
sheep(101118111) programmed cell death 2
domestic guinea pig(100732742) programmed cell death 2
naked mole-rat(101701624) programmed cell death 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002598 Rosetta Predictions human pricing
NM_144781 Rosetta Predictions human pricing
XM_001056283 Rosetta Predictions rat pricing
XM_341763 Rosetta Predictions rat pricing
NM_008799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229781 predicted 431
2 SASI_Hs02_00334104 predicted 296
3 SASI_Hs01_00229787 predicted 296
4 SASI_Hs02_00334105 predicted 442
5 SASI_Hs02_00334106 predicted 254
6 SASI_Hs02_00334107 predicted 286
7 SASI_Hs02_00334108 predicted 233
8 SASI_Hs02_00334109 predicted 295
9 SASI_Hs02_00334110 predicted 239
10 SASI_Hs01_00229778 predicted 514
11 SASI_Hs01_00229779 predicted 464
12 SASI_Hs01_00229780 predicted 473
13 SASI_Hs01_00229782 predicted 517
14 SASI_Hs01_00229783 predicted 343
15 SASI_Hs01_00229784 predicted 460
16 SASI_Hs01_00229785 predicted 517
17 SASI_Hs01_00229786 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233204 predicted 437
2 SASI_Hs02_00364729 predicted 296
3 SASI_Hs01_00233210 predicted 294
4 SASI_Hs02_00364730 predicted 442
5 SASI_Hs02_00364731 predicted 252
6 SASI_Hs02_00364732 predicted 290
7 SASI_Hs02_00364733 predicted 237
8 SASI_Hs02_00364734 predicted 300
9 SASI_Hs02_00364735 predicted 237
10 SASI_Hs01_00233201 predicted 513
11 SASI_Hs01_00233202 predicted 458
12 SASI_Hs01_00233203 predicted 473
13 SASI_Hs01_00233205 predicted 521
14 SASI_Hs01_00233206 predicted 341
15 SASI_Hs01_00233207 predicted 456
16 SASI_Hs01_00233208 predicted 517
17 SASI_Hs01_00233209 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282775 predicted 488
2 SASI_Rn02_00282776 predicted 895
3 SASI_Rn02_00282777 predicted 823
4 SASI_Rn02_00282778 predicted 575
5 SASI_Rn02_00282779 predicted 805
6 SASI_Rn02_00282780 predicted 497
7 SASI_Rn02_00282781 predicted 474
8 SASI_Rn02_00282782 predicted 752
9 SASI_Rn02_00282783 predicted 569
10 SASI_Rn02_00282784 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393320 predicted 1160
2 SASI_Rn02_00393321 predicted 818
3 SASI_Rn02_00393322 predicted 577
4 SASI_Rn02_00393323 predicted 805
5 SASI_Rn02_00393324 predicted 496
6 SASI_Rn02_00393325 predicted 816
7 SASI_Rn02_00393326 predicted 572
8 SASI_Rn02_00393327 predicted 717
9 SASI_Rn02_00393328 predicted 1145
10 SASI_Rn02_00393329 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101057 predicted 633
2 SASI_Mm01_00101058 predicted 463
3 SASI_Mm01_00101059 predicted 370
4 SASI_Mm01_00101060 predicted 557
5 SASI_Mm01_00101061 predicted 316
6 SASI_Mm01_00101062 predicted 450
7 SASI_Mm01_00101063 predicted 643
8 SASI_Mm01_00101064 predicted 693
9 SASI_Mm01_00101065 predicted 642
10 SASI_Mm02_00314712 predicted 580
11 SASI_Mm01_00101056 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002598
PDCD2 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002598.2-992s21c1
Sequence:CCGGAGACTGGGCAAGAGCATTGACCTCGAGGTCAATGCTCTTGCCCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-1059s1c1
Sequence:CCGGGTACTGGCTATACAGAAGAATCTCGAGATTCTTCTGTATAGCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002598.2-1160s1c1
Sequence:CCGGGCAATTCCATTTCTGGGATTTCTCGAGAAATCCCAGAAATGGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-869s1c1
Sequence:CCGGCCCATCTGGATTTCTGGTGAACTCGAGTTCACCAGAAATCCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-602s1c1
Sequence:CCGGCCAGATCATCTGGACCATATACTCGAGTATATGGTCCAGATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-605s1c1
Sequence:CCGGGATCATCTGGACCATATAATTCTCGAGAATTATATGGTCCAGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002598
PDCD2 MISSION shRNA shRNA Plasmid DNA
programmed cell death 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002598.2-992s21c1
Sequence:CCGGAGACTGGGCAAGAGCATTGACCTCGAGGTCAATGCTCTTGCCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-1059s1c1
Sequence:CCGGGTACTGGCTATACAGAAGAATCTCGAGATTCTTCTGTATAGCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002598.2-1160s1c1
Sequence:CCGGGCAATTCCATTTCTGGGATTTCTCGAGAAATCCCAGAAATGGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-869s1c1
Sequence:CCGGCCCATCTGGATTTCTGGTGAACTCGAGTTCACCAGAAATCCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-602s1c1
Sequence:CCGGCCAGATCATCTGGACCATATACTCGAGTATATGGTCCAGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-605s1c1
Sequence:CCGGGATCATCTGGACCATATAATTCTCGAGAATTATATGGTCCAGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002598
PDCD2 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002598.2-992s21c1
Sequence:CCGGAGACTGGGCAAGAGCATTGACCTCGAGGTCAATGCTCTTGCCCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-1059s1c1
Sequence:CCGGGTACTGGCTATACAGAAGAATCTCGAGATTCTTCTGTATAGCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002598.2-1160s1c1
Sequence:CCGGGCAATTCCATTTCTGGGATTTCTCGAGAAATCCCAGAAATGGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-869s1c1
Sequence:CCGGCCCATCTGGATTTCTGGTGAACTCGAGTTCACCAGAAATCCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-602s1c1
Sequence:CCGGCCAGATCATCTGGACCATATACTCGAGTATATGGTCCAGATGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002598.2-605s1c1
Sequence:CCGGGATCATCTGGACCATATAATTCTCGAGAATTATATGGTCCAGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008799
VALIDATED
PDCD2 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-582s21c1
Sequence:CCGGACTTCCTGTTTCCAGAATTTGCTCGAGCAAATTCTGGAAACAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-771s21c1
Sequence:CCGGCCCTTGAACCAGAGCAGATTCCTCGAGGAATCTGCTCTGGTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-612s21c1
Sequence:CCGGCAGAAACAGAAGATGAAATTTCTCGAGAAATTTCATCTTCTGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008799.2-872s21c1
Sequence:CCGGTGTGGTGCCAAGAGAATATTTCTCGAGAAATATTCTCTTGGCACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-716s21c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-305s1c1
Sequence:CCGGGCTACCAAGGAACAACGCATTCTCGAGAATGCGTTGTTCCTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-445s1c1
Sequence:CCGGCTAGGTGCAAACAGGCACATTCTCGAGAATGTGCCTGTTTGCACCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-785s1c1
Sequence:CCGGAGGGATTAAACCCATCTGGATCTCGAGATCCAGATGGGTTTAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-621s1c1
Sequence:CCGGGTTGTGGAAATGGAGGATTATCTCGAGATAATCCTCCATTTCCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-696s1c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008799
VALIDATED
PDCD2 MISSION shRNA shRNA Plasmid DNA
programmed cell death 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-582s21c1
Sequence:CCGGACTTCCTGTTTCCAGAATTTGCTCGAGCAAATTCTGGAAACAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-771s21c1
Sequence:CCGGCCCTTGAACCAGAGCAGATTCCTCGAGGAATCTGCTCTGGTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-612s21c1
Sequence:CCGGCAGAAACAGAAGATGAAATTTCTCGAGAAATTTCATCTTCTGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008799.2-872s21c1
Sequence:CCGGTGTGGTGCCAAGAGAATATTTCTCGAGAAATATTCTCTTGGCACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-716s21c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-305s1c1
Sequence:CCGGGCTACCAAGGAACAACGCATTCTCGAGAATGCGTTGTTCCTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-445s1c1
Sequence:CCGGCTAGGTGCAAACAGGCACATTCTCGAGAATGTGCCTGTTTGCACCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-785s1c1
Sequence:CCGGAGGGATTAAACCCATCTGGATCTCGAGATCCAGATGGGTTTAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-621s1c1
Sequence:CCGGGTTGTGGAAATGGAGGATTATCTCGAGATAATCCTCCATTTCCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-696s1c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008799
VALIDATED
PDCD2 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-582s21c1
Sequence:CCGGACTTCCTGTTTCCAGAATTTGCTCGAGCAAATTCTGGAAACAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-771s21c1
Sequence:CCGGCCCTTGAACCAGAGCAGATTCCTCGAGGAATCTGCTCTGGTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-612s21c1
Sequence:CCGGCAGAAACAGAAGATGAAATTTCTCGAGAAATTTCATCTTCTGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008799.2-872s21c1
Sequence:CCGGTGTGGTGCCAAGAGAATATTTCTCGAGAAATATTCTCTTGGCACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008799.2-716s21c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-305s1c1
Sequence:CCGGGCTACCAAGGAACAACGCATTCTCGAGAATGCGTTGTTCCTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-445s1c1
Sequence:CCGGCTAGGTGCAAACAGGCACATTCTCGAGAATGTGCCTGTTTGCACCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-785s1c1
Sequence:CCGGAGGGATTAAACCCATCTGGATCTCGAGATCCAGATGGGTTTAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-621s1c1
Sequence:CCGGGTTGTGGAAATGGAGGATTATCTCGAGATAATCCTCCATTTCCACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008799.1-696s1c1
Sequence:CCGGGCAAAGCACGAATCCAAGGAACTCGAGTTCCTTGGATTCGTGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)