EMAIL THIS PAGE TO A FRIEND

PDCD4

programmed cell death 4 (neoplastic transformation inhibitor)

118 Gene Product Result for
Synonyms: H731
Gene ID:
Human(27250) Summary: This gene is a tumor suppressor and encodes a protein that binds to the eukaryotic translation initiation factor 4A1 and inhibits its function by preventing RNA binding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(18569) programmed cell death 4
Rat(64031) programmed cell death 4
fruit fly(32337) Programmed cell death 4 ortholog
domestic cat(101093647) programmed cell death 4 (neoplastic transformation inhibitor)
dog(477818) programmed cell death 4 (neoplastic transformation inhibitor)
chicken(374191) programmed cell death 4 (neoplastic transformation inhibitor)
cow(506724) programmed cell death 4 (neoplastic transformation inhibitor)
sheep(101119688) programmed cell death 4 (neoplastic transformation inhibitor)
Goat(100861341) programmed cell death 4 (neoplastic transformation inhibitor)
domestic guinea pig(100723476) programmed cell death 4 (neoplastic transformation inhibitor)
naked mole-rat(101714329) programmed cell death 4 (neoplastic transformation inhibitor)
Domestic Rabbit(100354557) programmed cell death 4 (neoplastic transformation inhibitor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108450 Anti-PDCD4 affinity isolated antibody rabbit, bovine, pig, guinea pig, canine, rat, goat, mouse, human
western blot pricing
SAB2502080 Anti-PDCD4 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, bovine, canine, human, mouse, pig
ELISA, western blot pricing
SAB2502081 Anti-PDCD4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1407349 Anti-PDCD4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001032 Anti-PDCD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry, western blot pricing
P0071 Anti-PDCD4 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat (predicted), mouse (predicted)
immunoprecipitation (IP), western blot pricing
AV09045 Anti-PDCD4 antibody produced in rabbit affinity isolated antibody rat, canine, goat, guinea pig, mouse, human, bovine, rabbit
western blot pricing
HPA027214 Anti-PDCD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500256 Anti-PDCD4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1410539 Anti-PDCD4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504291 Anti-phospho-PDCD4 (pSer457) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301460 Anti-phospho-PDCD4 (pSer457) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
P0072 Anti-phospho-PDCD4 (pSer67) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), human, rat (predicted)
immunoprecipitation (IP), western blot pricing
SAB4504290 Anti-phospho-PDCD4 (pSer67) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301425 Anti-phospho-PDCD4 (pSer67) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB3701464 Monoclonal Anti-Pdcd4 pS457 antibody produced in mouse clone 9G6, purified immunoglobulin Xenopus, mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB3701424 Monoclonal Anti-Pdcd4 pS457-Biotin antibody produced in mouse clone 9G6, purified immunoglobulin Xenopus, mouse, rat, human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014456 Rosetta Predictions human pricing
NM_145341 Rosetta Predictions human pricing
NM_022265 Rosetta Predictions rat pricing
NM_011050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224493 predicted 1151
2 SASI_Hs01_00224494 predicted 490
3 SASI_Hs01_00224495 predicted 726
4 SASI_Hs02_00345673 predicted 538
5 SASI_Hs02_00345674 predicted 1261
6 SASI_Hs01_00224497 predicted 746
7 SASI_Hs01_00224499 predicted 1449
8 SASI_Hs01_00224500 predicted 1019
9 SASI_Hs01_00224501 predicted 713
10 SASI_Hs02_00345675 predicted 1479
11 SASI_Hs01_00224496 predicted 954
12 SASI_Hs01_00224498 predicted 1286
13 SASI_Hs01_00224502 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075959 predicted 1238
2 SASI_Hs01_00075960 predicted 571
3 SASI_Hs01_00075961 predicted 803
4 SASI_Hs02_00365236 predicted 622
5 SASI_Hs02_00365237 predicted 1344
6 SASI_Hs01_00075963 predicted 829
7 SASI_Hs01_00075965 predicted 1529
8 SASI_Hs01_00075966 predicted 1107
9 SASI_Hs01_00075967 predicted 793
10 SASI_Hs02_00365238 predicted 1567
11 SASI_Hs01_00075962 predicted 1038
12 SASI_Hs01_00075964 predicted 1365
13 SASI_Hs01_00075968 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263067 predicted 1170
2 SASI_Rn01_00048803 predicted 1172
3 SASI_Rn02_00263068 predicted 814
4 SASI_Rn01_00048805 predicted 899
5 SASI_Rn01_00048806 predicted 908
6 SASI_Rn01_00048807 predicted 1137
7 SASI_Rn01_00048808 predicted 1083
8 SASI_Rn01_00048809 predicted 782
9 SASI_Rn02_00263069 predicted 1120
10 SASI_Rn01_00048810 predicted 1183
11 SASI_Rn01_00048802 predicted 658
12 SASI_Rn01_00048804 predicted 437
13 SASI_Rn01_00048811 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187980 predicted 1280
2 SASI_Mm01_00187982 predicted 944
3 SASI_Mm02_00319798 predicted 768
4 SASI_Mm01_00187983 predicted 1274
5 SASI_Mm01_00187984 predicted 793
6 SASI_Mm01_00187986 predicted 1422
7 SASI_Mm01_00187987 predicted 1098
8 SASI_Mm01_00187988 predicted 523
9 SASI_Mm02_00319799 predicted 1526
10 SASI_Mm02_00319800 predicted 1492
11 SASI_Mm01_00187979 predicted 1294
12 SASI_Mm01_00187981 predicted 1172
13 SASI_Mm01_00187985 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014456
VALIDATED
PDCD4 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 4 (neoplastic transformation inhibitor)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1299s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1524s21c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1665s21c1
Sequence:CCGGCTTGCAGTCTTAGATGTTATACTCGAGTATAACATCTAAGACTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-492s21c1
Sequence:CCGGCGCCCTTAGAAGTGGATTAACCTCGAGGTTAATCCACTTCTAAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1469s21c1
Sequence:CCGGACAATGAAATTCCGGACATTACTCGAGTAATGTCCGGAATTTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-769s21c1
Sequence:CCGGTTTGAGCATGGAGATACTAATCTCGAGATTAGTATCTCCATGCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-653s21c1
Sequence:CCGGATGTGAAAGATCCTAACTATGCTCGAGCATAGTTAGGATCTTTCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1760s21c1
Sequence:CCGGTACAAGGCATTTCTGACATTTCTCGAGAAATGTCAGAAATGCCTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014456.3-1524s1c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-1424s1c1
Sequence:CCGGCTACCATTACTGTAGACCAAACTCGAGTTTGGTCTACAGTAATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-914s1c1
Sequence:CCGGCTGACCTTTGTGGGACAGTAACTCGAGTTACTGTCCCACAAAGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-386s1c1
Sequence:CCGGCCTCCATTAACGAAGCTAGAACTCGAGTTCTAGCTTCGTTAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014456
VALIDATED
PDCD4 MISSION shRNA shRNA Plasmid DNA
programmed cell death 4 (neoplastic transformation inhibitor)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1299s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1524s21c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1665s21c1
Sequence:CCGGCTTGCAGTCTTAGATGTTATACTCGAGTATAACATCTAAGACTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-492s21c1
Sequence:CCGGCGCCCTTAGAAGTGGATTAACCTCGAGGTTAATCCACTTCTAAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1469s21c1
Sequence:CCGGACAATGAAATTCCGGACATTACTCGAGTAATGTCCGGAATTTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-769s21c1
Sequence:CCGGTTTGAGCATGGAGATACTAATCTCGAGATTAGTATCTCCATGCTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-653s21c1
Sequence:CCGGATGTGAAAGATCCTAACTATGCTCGAGCATAGTTAGGATCTTTCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1760s21c1
Sequence:CCGGTACAAGGCATTTCTGACATTTCTCGAGAAATGTCAGAAATGCCTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014456.3-1524s1c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-1424s1c1
Sequence:CCGGCTACCATTACTGTAGACCAAACTCGAGTTTGGTCTACAGTAATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-914s1c1
Sequence:CCGGCTGACCTTTGTGGGACAGTAACTCGAGTTACTGTCCCACAAAGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-386s1c1
Sequence:CCGGCCTCCATTAACGAAGCTAGAACTCGAGTTCTAGCTTCGTTAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014456
VALIDATED
PDCD4 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 4 (neoplastic transformation inhibitor)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1299s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1524s21c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1665s21c1
Sequence:CCGGCTTGCAGTCTTAGATGTTATACTCGAGTATAACATCTAAGACTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-492s21c1
Sequence:CCGGCGCCCTTAGAAGTGGATTAACCTCGAGGTTAATCCACTTCTAAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-1469s21c1
Sequence:CCGGACAATGAAATTCCGGACATTACTCGAGTAATGTCCGGAATTTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-769s21c1
Sequence:CCGGTTTGAGCATGGAGATACTAATCTCGAGATTAGTATCTCCATGCTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014456.3-653s21c1
Sequence:CCGGATGTGAAAGATCCTAACTATGCTCGAGCATAGTTAGGATCTTTCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014456.3-1760s21c1
Sequence:CCGGTACAAGGCATTTCTGACATTTCTCGAGAAATGTCAGAAATGCCTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014456.3-1524s1c1
Sequence:CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-1424s1c1
Sequence:CCGGCTACCATTACTGTAGACCAAACTCGAGTTTGGTCTACAGTAATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-914s1c1
Sequence:CCGGCTGACCTTTGTGGGACAGTAACTCGAGTTACTGTCCCACAAAGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014456.3-386s1c1
Sequence:CCGGCCTCCATTAACGAAGCTAGAACTCGAGTTCTAGCTTCGTTAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011050
VALIDATED
PDCD4 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 4 (neoplastic transformation inhibitor)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-2123s21c1
Sequence:CCGGGGGTGAGTGAAGCTACTAAACCTCGAGGTTTAGTAGCTTCACTCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-423s21c1
Sequence:CCGGATTTCCGCATCTACTATTAATCTCGAGATTAATAGTAGATGCGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1711s21c1
Sequence:CCGGTCTTACAGTCTTAGGTGTTACCTCGAGGTAACACCTAAGACTGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1346s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-787s21c1
Sequence:CCGGAGACTCTAACACCAATTATACCTCGAGGTATAATTGGTGTTAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011050.3-1257s21c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011050.1-1785s1c1
Sequence:CCGGACTTTCTAAGTGCCATGTTTACTCGAGTAAACATGGCACTTAGAAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-639s1c1
Sequence:CCGGGCGGAGATGTTAAGAGACTTACTCGAGTAAGTCTCTTAACATCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1053s1c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1169s1c1
Sequence:CCGGCGAGCTTGTATATGAAGCCATCTCGAGATGGCTTCATATACAAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1344s1c1
Sequence:CCGGCCGCACTCATACTCTGTTCTTCTCGAGAAGAACAGAGTATGAGTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011050
VALIDATED
PDCD4 MISSION shRNA shRNA Plasmid DNA
programmed cell death 4 (neoplastic transformation inhibitor)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-2123s21c1
Sequence:CCGGGGGTGAGTGAAGCTACTAAACCTCGAGGTTTAGTAGCTTCACTCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-423s21c1
Sequence:CCGGATTTCCGCATCTACTATTAATCTCGAGATTAATAGTAGATGCGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1711s21c1
Sequence:CCGGTCTTACAGTCTTAGGTGTTACCTCGAGGTAACACCTAAGACTGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1346s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-787s21c1
Sequence:CCGGAGACTCTAACACCAATTATACCTCGAGGTATAATTGGTGTTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011050.3-1257s21c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011050.1-1785s1c1
Sequence:CCGGACTTTCTAAGTGCCATGTTTACTCGAGTAAACATGGCACTTAGAAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-639s1c1
Sequence:CCGGGCGGAGATGTTAAGAGACTTACTCGAGTAAGTCTCTTAACATCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1053s1c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1169s1c1
Sequence:CCGGCGAGCTTGTATATGAAGCCATCTCGAGATGGCTTCATATACAAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1344s1c1
Sequence:CCGGCCGCACTCATACTCTGTTCTTCTCGAGAAGAACAGAGTATGAGTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011050
VALIDATED
PDCD4 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 4 (neoplastic transformation inhibitor)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-2123s21c1
Sequence:CCGGGGGTGAGTGAAGCTACTAAACCTCGAGGTTTAGTAGCTTCACTCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-423s21c1
Sequence:CCGGATTTCCGCATCTACTATTAATCTCGAGATTAATAGTAGATGCGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1711s21c1
Sequence:CCGGTCTTACAGTCTTAGGTGTTACCTCGAGGTAACACCTAAGACTGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-1346s21c1
Sequence:CCGGGGAACTGGAAGTACCTCATTTCTCGAGAAATGAGGTACTTCCAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011050.3-787s21c1
Sequence:CCGGAGACTCTAACACCAATTATACCTCGAGGTATAATTGGTGTTAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011050.3-1257s21c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011050.1-1785s1c1
Sequence:CCGGACTTTCTAAGTGCCATGTTTACTCGAGTAAACATGGCACTTAGAAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-639s1c1
Sequence:CCGGGCGGAGATGTTAAGAGACTTACTCGAGTAAGTCTCTTAACATCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1053s1c1
Sequence:CCGGCCTGTCAATCACCTTGTTAAACTCGAGTTTAACAAGGTGATTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1169s1c1
Sequence:CCGGCGAGCTTGTATATGAAGCCATCTCGAGATGGCTTCATATACAAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011050.1-1344s1c1
Sequence:CCGGCCGCACTCATACTCTGTTCTTCTCGAGAAGAACAGAGTATGAGTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)