EMAIL THIS PAGE TO A FRIEND

PDCD6

programmed cell death 6

88 Gene Product Result for
Synonyms: ALG-2 PEF1B
UniProtKB ID: O75340, B2RD16, E7ESR3, Q2YDC2, Q5TZS0
Gene ID:
Human(10016) Summary: This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]
Mouse(18570) programmed cell death 6
Rat(308061) programmed cell death 6
cow(100125927) programmed cell death 6
sheep(101109042) programmed cell death 6
domestic guinea pig(100716410) programmed cell death 6
naked mole-rat(101698591) programmed cell death 6
Zebrafish(393925) programmed cell death 6
domestic cat(101096541) programmed cell death 6
dog(609549) programmed cell death 6
chicken(420988) programmed cell death 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013232 Rosetta Predictions human pricing
NM_001107452 Rosetta Predictions rat pricing
NM_011051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030269 predicted 800
2 SASI_Hs01_00030270 predicted 527
3 SASI_Hs01_00030271 predicted 695
4 SASI_Hs01_00030272 predicted 483
5 SASI_Hs01_00030273 predicted 866
6 SASI_Hs02_00344422 predicted 491
7 SASI_Hs01_00030275 predicted 855
8 SASI_Hs02_00344423 predicted 805
9 SASI_Hs01_00030276 predicted 747
10 SASI_Hs01_00030277 predicted 848
11 SASI_Hs01_00030274 predicted 603
12 SASI_Hs01_00030278 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228965 predicted 349
2 SASI_Rn02_00228966 predicted 603
3 SASI_Rn02_00228967 predicted 504
4 SASI_Rn02_00228968 predicted 665
5 SASI_Rn02_00228969 predicted 295
6 SASI_Rn02_00228970 predicted 276
7 SASI_Rn02_00228971 predicted 448
8 SASI_Rn02_00228972 predicted 869
9 SASI_Rn02_00228973 predicted 260
10 SASI_Rn02_00228974 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182542 predicted 594
2 SASI_Mm01_00182546 predicted 500
3 SASI_Mm02_00319801 predicted 732
4 SASI_Mm02_00319802 predicted 853
5 SASI_Mm02_00319803 predicted 633
6 SASI_Mm02_00319804 predicted 235
7 SASI_Mm02_00319805 predicted 265
8 SASI_Mm02_00319806 predicted 610
9 SASI_Mm02_00319807 predicted 287
10 SASI_Mm02_00319808 predicted 459
11 SASI_Mm01_00182540 predicted 593
12 SASI_Mm01_00182541 predicted 360
13 SASI_Mm01_00182543 predicted 676
14 SASI_Mm01_00182544 predicted 569
15 SASI_Mm01_00182545 predicted 570
16 SASI_Mm01_00182547 predicted 779
17 SASI_Mm01_00182548 predicted 230
18 SASI_Mm01_00182549 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013232
VALIDATED
PDCD6 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-493s21c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-852s21c1
Sequence:CCGGTAGTAGCTGTATCGTTCTAATCTCGAGATTAGAACGATACAGCTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-334s21c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-415s21c1
Sequence:CCGGCAACTCCGGGATGATCGATAACTCGAGTTATCGATCATCCCGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-574s21c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-651s1c1
Sequence:CCGGCCATGGTCTTCAGTATCGTATCTCGAGATACGATACTGAAGACCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013232.2-293s1c1
Sequence:CCGGAGGTCGATCATATCCATGTTTCTCGAGAAACATGGATATGATCGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-571s1c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-490s1c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-331s1c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013232
VALIDATED
PDCD6 MISSION shRNA shRNA Plasmid DNA
programmed cell death 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-493s21c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-852s21c1
Sequence:CCGGTAGTAGCTGTATCGTTCTAATCTCGAGATTAGAACGATACAGCTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-334s21c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-415s21c1
Sequence:CCGGCAACTCCGGGATGATCGATAACTCGAGTTATCGATCATCCCGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-574s21c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-651s1c1
Sequence:CCGGCCATGGTCTTCAGTATCGTATCTCGAGATACGATACTGAAGACCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013232.2-293s1c1
Sequence:CCGGAGGTCGATCATATCCATGTTTCTCGAGAAACATGGATATGATCGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-571s1c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-490s1c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-331s1c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013232
VALIDATED
PDCD6 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-493s21c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-852s21c1
Sequence:CCGGTAGTAGCTGTATCGTTCTAATCTCGAGATTAGAACGATACAGCTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-334s21c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-415s21c1
Sequence:CCGGCAACTCCGGGATGATCGATAACTCGAGTTATCGATCATCCCGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013232.3-574s21c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-651s1c1
Sequence:CCGGCCATGGTCTTCAGTATCGTATCTCGAGATACGATACTGAAGACCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013232.2-293s1c1
Sequence:CCGGAGGTCGATCATATCCATGTTTCTCGAGAAACATGGATATGATCGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-571s1c1
Sequence:CCGGGCAGAGGTTGACGGATATATTCTCGAGAATATATCCGTCAACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-490s1c1
Sequence:CCGGCGACATCCTCATTCGAAAGTTCTCGAGAACTTTCGAATGAGGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_013232.2-331s1c1
Sequence:CCGGCGGCGTGAACTTCAGCGAGTTCTCGAGAACTCGCTGAAGTTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011051
VALIDATED
PDCD6 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011051.2-1116s1c1
Sequence:CCGGGCCGTTTGTTACACTACTCTACTCGAGTAGAGTAGTGTAACAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-517s1c1
Sequence:CCGGGCAGAGGTTGACAGACATATTCTCGAGAATATGTCTGTCAACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-276s1c1
Sequence:CCGGCTGGTGTGAACTTCAGTGAATCTCGAGATTCACTGAAGTTCACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-572s1c1
Sequence:CCGGCAGGTGTCTTATGAGCAATATCTCGAGATATTGCTCATAAGACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-201s1c1
Sequence:CCGGCCAATGGTACATGGACTCCATCTCGAGATGGAGTCCATGTACCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011051
VALIDATED
PDCD6 MISSION shRNA shRNA Plasmid DNA
programmed cell death 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011051.2-1116s1c1
Sequence:CCGGGCCGTTTGTTACACTACTCTACTCGAGTAGAGTAGTGTAACAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-517s1c1
Sequence:CCGGGCAGAGGTTGACAGACATATTCTCGAGAATATGTCTGTCAACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-276s1c1
Sequence:CCGGCTGGTGTGAACTTCAGTGAATCTCGAGATTCACTGAAGTTCACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-572s1c1
Sequence:CCGGCAGGTGTCTTATGAGCAATATCTCGAGATATTGCTCATAAGACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-201s1c1
Sequence:CCGGCCAATGGTACATGGACTCCATCTCGAGATGGAGTCCATGTACCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011051
VALIDATED
PDCD6 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011051.2-1116s1c1
Sequence:CCGGGCCGTTTGTTACACTACTCTACTCGAGTAGAGTAGTGTAACAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-517s1c1
Sequence:CCGGGCAGAGGTTGACAGACATATTCTCGAGAATATGTCTGTCAACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-276s1c1
Sequence:CCGGCTGGTGTGAACTTCAGTGAATCTCGAGATTCACTGAAGTTCACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-572s1c1
Sequence:CCGGCAGGTGTCTTATGAGCAATATCTCGAGATATTGCTCATAAGACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011051.2-201s1c1
Sequence:CCGGCCAATGGTACATGGACTCCATCTCGAGATGGAGTCCATGTACCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)