EMAIL THIS PAGE TO A FRIEND

PDCD7

programmed cell death 7

90 Gene Product Result for
Synonyms: ES18 HES18
UniProtKB ID: Q8N8D1, Q96AK8, Q9Y6D7
Gene ID:
Human(10081) Summary: This gene encodes a 59 kDa protein that is associated with the U11 small nuclear ribonucleoprotein (snRNP), which is a component of the minor U12-type spliceosome responsible for catalyzing pre-mRNA splicing of U12-type introns. [provided by RefSeq, Dec 2010]
Mouse(50996) programmed cell death 7
Rat(363082) programmed cell death 7
cow(784973) programmed cell death 7
sheep(101110945) programmed cell death 7
domestic guinea pig(100714705) programmed cell death 7
naked mole-rat(101724702) programmed cell death 7
Zebrafish(445020) programmed cell death 7
chicken(415528) programmed cell death 7
domestic cat(101096237) programmed cell death 7
dog(612964) programmed cell death 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005707 Rosetta Predictions human pricing
NM_001108768 Rosetta Predictions rat pricing
NM_016688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218209 predicted 1826
2 SASI_Hs01_00218210 predicted 1591
3 SASI_Hs02_00340123 predicted 1825
4 SASI_Hs01_00218211 predicted 1749
5 SASI_Hs01_00218212 predicted 1544
6 SASI_Hs01_00218214 predicted 1824
7 SASI_Hs01_00218215 predicted 1872
8 SASI_Hs01_00218216 predicted 1970
9 SASI_Hs01_00218217 predicted 1842
10 SASI_Hs02_00340124 predicted 1756
11 SASI_Hs01_00218213 predicted 1970
12 SASI_Hs01_00218218 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241885 predicted 1543
2 SASI_Rn02_00241886 predicted 1740
3 SASI_Rn02_00241887 predicted 1419
4 SASI_Rn02_00241888 predicted 1832
5 SASI_Rn02_00241889 predicted 1847
6 SASI_Rn02_00241890 predicted 1438
7 SASI_Rn02_00241891 predicted 1518
8 SASI_Rn02_00241892 predicted 1631
9 SASI_Rn02_00241893 predicted 1746
10 SASI_Rn02_00241894 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176487 predicted 1512
2 SASI_Mm02_00323341 predicted 1824
3 SASI_Mm02_00323342 predicted 1952
4 SASI_Mm01_00176488 predicted 1522
5 SASI_Mm02_00323343 predicted 1627
6 SASI_Mm01_00176489 predicted 970
7 SASI_Mm02_00323344 predicted 1875
8 SASI_Mm02_00323345 predicted 701
9 SASI_Mm01_00176491 predicted 1600
10 SASI_Mm02_00323346 predicted 1553
11 SASI_Mm01_00176486 predicted 1256
12 SASI_Mm01_00176490 predicted 1722
13 SASI_Mm01_00176492 predicted 1503
14 SASI_Mm01_00176493 predicted 1015
15 SASI_Mm01_00176494 predicted 973
16 SASI_Mm01_00176495 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005707
VALIDATED
PDCD7 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1413s21c1
Sequence:CCGGTGCCATCCGATCATCCCAAAGCTCGAGCTTTGGGATGATCGGATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1475s21c1
Sequence:CCGGAGCAACGACATCTGGGCAACTCTCGAGAGTTGCCCAGATGTCGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1378s21c1
Sequence:CCGGCATCCAGATCAGGCATGATTGCTCGAGCAATCATGCCTGATCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005707.1-1593s21c1
Sequence:CCGGGACTAAACTGCAACTTCTAAACTCGAGTTTAGAAGTTGCAGTTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005707.1-955s1c1
Sequence:CCGGCGTACTATCTGAAGTGAGGAACTCGAGTTCCTCACTTCAGATAGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1178s1c1
Sequence:CCGGGTTATGCTAGAAGGAGAACAACTCGAGTTGTTCTCCTTCTAGCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1264s1c1
Sequence:CCGGGAAACGTGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1630s1c1
Sequence:CCGGCCTACCCTGAAGTTATGCTTTCTCGAGAAAGCATAACTTCAGGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005707.1-1387s1c1
Sequence:CCGGCAGGCATGATTGGGATCAGTACTCGAGTACTGATCCCAATCATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1295s1c1
Sequence:CCGGGATCCAGATGAGTTCCCACTTCTCGAGAAGTGGGAACTCATCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005707
VALIDATED
PDCD7 MISSION shRNA shRNA Plasmid DNA
programmed cell death 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1413s21c1
Sequence:CCGGTGCCATCCGATCATCCCAAAGCTCGAGCTTTGGGATGATCGGATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1475s21c1
Sequence:CCGGAGCAACGACATCTGGGCAACTCTCGAGAGTTGCCCAGATGTCGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1378s21c1
Sequence:CCGGCATCCAGATCAGGCATGATTGCTCGAGCAATCATGCCTGATCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005707.1-1593s21c1
Sequence:CCGGGACTAAACTGCAACTTCTAAACTCGAGTTTAGAAGTTGCAGTTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005707.1-955s1c1
Sequence:CCGGCGTACTATCTGAAGTGAGGAACTCGAGTTCCTCACTTCAGATAGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1178s1c1
Sequence:CCGGGTTATGCTAGAAGGAGAACAACTCGAGTTGTTCTCCTTCTAGCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1264s1c1
Sequence:CCGGGAAACGTGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1630s1c1
Sequence:CCGGCCTACCCTGAAGTTATGCTTTCTCGAGAAAGCATAACTTCAGGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005707.1-1387s1c1
Sequence:CCGGCAGGCATGATTGGGATCAGTACTCGAGTACTGATCCCAATCATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1295s1c1
Sequence:CCGGGATCCAGATGAGTTCCCACTTCTCGAGAAGTGGGAACTCATCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005707
VALIDATED
PDCD7 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1413s21c1
Sequence:CCGGTGCCATCCGATCATCCCAAAGCTCGAGCTTTGGGATGATCGGATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1475s21c1
Sequence:CCGGAGCAACGACATCTGGGCAACTCTCGAGAGTTGCCCAGATGTCGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005707.1-1378s21c1
Sequence:CCGGCATCCAGATCAGGCATGATTGCTCGAGCAATCATGCCTGATCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005707.1-1593s21c1
Sequence:CCGGGACTAAACTGCAACTTCTAAACTCGAGTTTAGAAGTTGCAGTTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005707.1-955s1c1
Sequence:CCGGCGTACTATCTGAAGTGAGGAACTCGAGTTCCTCACTTCAGATAGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1178s1c1
Sequence:CCGGGTTATGCTAGAAGGAGAACAACTCGAGTTGTTCTCCTTCTAGCATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1264s1c1
Sequence:CCGGGAAACGTGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1630s1c1
Sequence:CCGGCCTACCCTGAAGTTATGCTTTCTCGAGAAAGCATAACTTCAGGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005707.1-1387s1c1
Sequence:CCGGCAGGCATGATTGGGATCAGTACTCGAGTACTGATCCCAATCATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005707.1-1295s1c1
Sequence:CCGGGATCCAGATGAGTTCCCACTTCTCGAGAAGTGGGAACTCATCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016688
VALIDATED
PDCD7 MISSION shRNA Bacterial Glycerol Stock
programmed cell death 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016688.2-1728s21c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1342s21c1
Sequence:CCGGTGCAGCCATTCCGGCAGTATTCTCGAGAATACTGCCGGAATGGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016688.2-1129s21c1
Sequence:CCGGAGCGGCTGAGAAAGCTCATTACTCGAGTAATGAGCTTTCTCAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016688.2-1728s1c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1272s21c1
Sequence:CCGGCTACTACAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTGTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1509s21c1
Sequence:CCGGACGGCCATTCAGCTGCATTAACTCGAGTTAATGCAGCTGAATGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1251s1c1
Sequence:CCGGGAGAAAGAGAAACTTCTACTACTCGAGTAGTAGAAGTTTCTCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1274s1c1
Sequence:CCGGGAAACGGGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCCCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016688
VALIDATED
PDCD7 MISSION shRNA shRNA Plasmid DNA
programmed cell death 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016688.2-1728s21c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1342s21c1
Sequence:CCGGTGCAGCCATTCCGGCAGTATTCTCGAGAATACTGCCGGAATGGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016688.2-1129s21c1
Sequence:CCGGAGCGGCTGAGAAAGCTCATTACTCGAGTAATGAGCTTTCTCAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016688.2-1728s1c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1272s21c1
Sequence:CCGGCTACTACAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTGTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1509s21c1
Sequence:CCGGACGGCCATTCAGCTGCATTAACTCGAGTTAATGCAGCTGAATGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1251s1c1
Sequence:CCGGGAGAAAGAGAAACTTCTACTACTCGAGTAGTAGAAGTTTCTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1274s1c1
Sequence:CCGGGAAACGGGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCCCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016688
VALIDATED
PDCD7 MISSION shRNA Lentiviral Transduction Particles
programmed cell death 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016688.2-1728s21c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1342s21c1
Sequence:CCGGTGCAGCCATTCCGGCAGTATTCTCGAGAATACTGCCGGAATGGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016688.2-1129s21c1
Sequence:CCGGAGCGGCTGAGAAAGCTCATTACTCGAGTAATGAGCTTTCTCAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016688.2-1728s1c1
Sequence:CCGGCTAGATGAACTGAGGTTATTACTCGAGTAATAACCTCAGTTCATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1272s21c1
Sequence:CCGGCTACTACAGAAACGGGAAATTCTCGAGAATTTCCCGTTTCTGTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016688.2-1509s21c1
Sequence:CCGGACGGCCATTCAGCTGCATTAACTCGAGTTAATGCAGCTGAATGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1251s1c1
Sequence:CCGGGAGAAAGAGAAACTTCTACTACTCGAGTAGTAGAAGTTTCTCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016688.1-1274s1c1
Sequence:CCGGGAAACGGGAAATTGAGTCCAACTCGAGTTGGACTCAATTTCCCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)