EMAIL THIS PAGE TO A FRIEND

PDCL3

phosducin-like 3

54 Gene Product Result for
Synonyms: HTPHLP PHLP2A PHLP3 VIAF VIAF1
UniProtKB ID: Q9H2J4, B2RA00, Q53S68
Gene ID:
Human(79031) Summary: This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Mouse(68833) phosducin-like 3
Rat(316348) phosducin-like 3
Zebrafish(403034) phosducin-like 3
chicken(418709) phosducin-like 3
domestic cat(101082741) phosducin-like 3
dog(474553) phosducin-like 3
naked mole-rat(101702504) phosducin-like 3
cow(514033) phosducin-like 3
sheep(101105318) phosducin-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024065 Rosetta Predictions human pricing
NM_001025709 Rosetta Predictions rat pricing
NM_026850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356519 predicted 374
2 SASI_Hs02_00356520 predicted 456
3 SASI_Hs01_00081548 predicted 592
4 SASI_Hs02_00356521 predicted 408
5 SASI_Hs02_00356522 predicted 594
6 SASI_Hs02_00356523 predicted 399
7 SASI_Hs02_00356524 predicted 459
8 SASI_Hs02_00356525 predicted 570
9 SASI_Hs01_00081540 predicted 274
10 SASI_Hs02_00356526 predicted 625
11 SASI_Hs01_00081539 predicted 527
12 SASI_Hs01_00081541 predicted 300
13 SASI_Hs01_00081542 predicted 405
14 SASI_Hs01_00081543 predicted 390
15 SASI_Hs01_00081544 predicted 449
16 SASI_Hs01_00081545 predicted 277
17 SASI_Hs01_00081546 predicted 484
18 SASI_Hs01_00081547 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096811 predicted 841
2 SASI_Rn02_00203331 predicted 773
3 SASI_Rn01_00096813 predicted 815
4 SASI_Rn01_00096814 predicted 589
5 SASI_Rn01_00096815 predicted 629
6 SASI_Rn01_00096816 predicted 1028
7 SASI_Rn01_00096817 predicted 954
8 SASI_Rn01_00096818 predicted 418
9 SASI_Rn01_00096819 predicted 926
10 SASI_Rn01_00096820 predicted 1083
11 SASI_Rn01_00096812 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139407 predicted 450
2 SASI_Mm01_00139408 predicted 370
3 SASI_Mm01_00139409 predicted 731
4 SASI_Mm01_00139410 predicted 374
5 SASI_Mm01_00139411 predicted 762
6 SASI_Mm01_00139412 predicted 385
7 SASI_Mm01_00139413 predicted 589
8 SASI_Mm01_00139414 predicted 452
9 SASI_Mm01_00139415 predicted 480
10 SASI_Mm01_00139416 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026850
PDCL3 MISSION shRNA Bacterial Glycerol Stock
phosducin-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026850.2-968s1c1
Sequence:CCGGGCTTGTTATGTCACATATCTACTCGAGTAGATATGTGACATAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-333s1c1
Sequence:CCGGAGGACTATGTTCAAGAAGTTACTCGAGTAACTTCTTGAACATAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-458s1c1
Sequence:CCGGCCCGATGTGAAATTTATCAAACTCGAGTTTGATAAATTTCACATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-284s1c1
Sequence:CCGGGCAACTCAGCTGAAGAACAAACTCGAGTTTGTTCTTCAGCTGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-479s1c1
Sequence:CCGGGCCATTTCAACGACCTGCATACTCGAGTATGCAGGTCGTTGAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-57s21c1
Sequence:CCGGGTGGAATGACATCCTACGTAACTCGAGTTACGTAGGATGTCATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026850.4-1220s21c1
Sequence:CCGGTTGAGACAGATACTGATTTATCTCGAGATAAATCAGTATCTGTCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-377s21c1
Sequence:CCGGTGATCTTACACCTGTACAAACCTCGAGGTTTGTACAGGTGTAAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-627s21c1
Sequence:CCGGGTCTGAGTCAGGAGCGATCAACTCGAGTTGATCGCTCCTGACTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026850
PDCL3 MISSION shRNA shRNA Plasmid DNA
phosducin-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026850.2-968s1c1
Sequence:CCGGGCTTGTTATGTCACATATCTACTCGAGTAGATATGTGACATAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-333s1c1
Sequence:CCGGAGGACTATGTTCAAGAAGTTACTCGAGTAACTTCTTGAACATAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-458s1c1
Sequence:CCGGCCCGATGTGAAATTTATCAAACTCGAGTTTGATAAATTTCACATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-284s1c1
Sequence:CCGGGCAACTCAGCTGAAGAACAAACTCGAGTTTGTTCTTCAGCTGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-479s1c1
Sequence:CCGGGCCATTTCAACGACCTGCATACTCGAGTATGCAGGTCGTTGAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-57s21c1
Sequence:CCGGGTGGAATGACATCCTACGTAACTCGAGTTACGTAGGATGTCATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026850.4-1220s21c1
Sequence:CCGGTTGAGACAGATACTGATTTATCTCGAGATAAATCAGTATCTGTCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-377s21c1
Sequence:CCGGTGATCTTACACCTGTACAAACCTCGAGGTTTGTACAGGTGTAAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-627s21c1
Sequence:CCGGGTCTGAGTCAGGAGCGATCAACTCGAGTTGATCGCTCCTGACTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026850
PDCL3 MISSION shRNA Lentiviral Transduction Particles
phosducin-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026850.2-968s1c1
Sequence:CCGGGCTTGTTATGTCACATATCTACTCGAGTAGATATGTGACATAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-333s1c1
Sequence:CCGGAGGACTATGTTCAAGAAGTTACTCGAGTAACTTCTTGAACATAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-458s1c1
Sequence:CCGGCCCGATGTGAAATTTATCAAACTCGAGTTTGATAAATTTCACATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-284s1c1
Sequence:CCGGGCAACTCAGCTGAAGAACAAACTCGAGTTTGTTCTTCAGCTGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026850.2-479s1c1
Sequence:CCGGGCCATTTCAACGACCTGCATACTCGAGTATGCAGGTCGTTGAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-57s21c1
Sequence:CCGGGTGGAATGACATCCTACGTAACTCGAGTTACGTAGGATGTCATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026850.4-1220s21c1
Sequence:CCGGTTGAGACAGATACTGATTTATCTCGAGATAAATCAGTATCTGTCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-377s21c1
Sequence:CCGGTGATCTTACACCTGTACAAACCTCGAGGTTTGTACAGGTGTAAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026850.4-627s21c1
Sequence:CCGGGTCTGAGTCAGGAGCGATCAACTCGAGTTGATCGCTCCTGACTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024065
VALIDATED
PDCL3 MISSION shRNA Bacterial Glycerol Stock
phosducin-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-283s21c1
Sequence:CCGGGGATCATGAAGACGAGTTTAACTCGAGTTAAACTCGTCTTCATGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-865s21c1
Sequence:CCGGTGTGACAAATTGTCTGGATTTCTCGAGAAATCCAGACAATTTGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024065.3-845s1c1
Sequence:CCGGCCGAACTTTCTTGTGACAAATCTCGAGATTTGTCACAAGAAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-454s1c1
Sequence:CCGGGCACCTTTACAAACAAGGAATCTCGAGATTCCTTGTTTGTAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-131s1c1
Sequence:CCGGTGGAATGACATCTTACGCAAACTCGAGTTTGCGTAAGATGTCATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-564s1c1
Sequence:CCGGGCATACCCAATTATCCTGATACTCGAGTATCAGGATAATTGGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-168s1c1
Sequence:CCGGCCAAGGAAAGTCTGAAAGAATCTCGAGATTCTTTCAGACTTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-566s21c1
Sequence:CCGGACAACCTGCATACCCAATTATCTCGAGATAATTGGGTATGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-593s21c1
Sequence:CCGGAGGAATCTGCCCACGATATTTCTCGAGAAATATCGTGGGCAGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-399s21c1
Sequence:CCGGAGATCTCAGGGAAGGATTATGCTCGAGCATAATCCTTCCCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024065
VALIDATED
PDCL3 MISSION shRNA shRNA Plasmid DNA
phosducin-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-283s21c1
Sequence:CCGGGGATCATGAAGACGAGTTTAACTCGAGTTAAACTCGTCTTCATGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-865s21c1
Sequence:CCGGTGTGACAAATTGTCTGGATTTCTCGAGAAATCCAGACAATTTGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024065.3-845s1c1
Sequence:CCGGCCGAACTTTCTTGTGACAAATCTCGAGATTTGTCACAAGAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-454s1c1
Sequence:CCGGGCACCTTTACAAACAAGGAATCTCGAGATTCCTTGTTTGTAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-131s1c1
Sequence:CCGGTGGAATGACATCTTACGCAAACTCGAGTTTGCGTAAGATGTCATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-564s1c1
Sequence:CCGGGCATACCCAATTATCCTGATACTCGAGTATCAGGATAATTGGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-168s1c1
Sequence:CCGGCCAAGGAAAGTCTGAAAGAATCTCGAGATTCTTTCAGACTTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-566s21c1
Sequence:CCGGACAACCTGCATACCCAATTATCTCGAGATAATTGGGTATGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-593s21c1
Sequence:CCGGAGGAATCTGCCCACGATATTTCTCGAGAAATATCGTGGGCAGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-399s21c1
Sequence:CCGGAGATCTCAGGGAAGGATTATGCTCGAGCATAATCCTTCCCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024065
VALIDATED
PDCL3 MISSION shRNA Lentiviral Transduction Particles
phosducin-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-283s21c1
Sequence:CCGGGGATCATGAAGACGAGTTTAACTCGAGTTAAACTCGTCTTCATGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-865s21c1
Sequence:CCGGTGTGACAAATTGTCTGGATTTCTCGAGAAATCCAGACAATTTGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024065.3-845s1c1
Sequence:CCGGCCGAACTTTCTTGTGACAAATCTCGAGATTTGTCACAAGAAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-454s1c1
Sequence:CCGGGCACCTTTACAAACAAGGAATCTCGAGATTCCTTGTTTGTAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-131s1c1
Sequence:CCGGTGGAATGACATCTTACGCAAACTCGAGTTTGCGTAAGATGTCATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-564s1c1
Sequence:CCGGGCATACCCAATTATCCTGATACTCGAGTATCAGGATAATTGGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024065.3-168s1c1
Sequence:CCGGCCAAGGAAAGTCTGAAAGAATCTCGAGATTCTTTCAGACTTTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-566s21c1
Sequence:CCGGACAACCTGCATACCCAATTATCTCGAGATAATTGGGTATGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-593s21c1
Sequence:CCGGAGGAATCTGCCCACGATATTTCTCGAGAAATATCGTGGGCAGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024065.4-399s21c1
Sequence:CCGGAGATCTCAGGGAAGGATTATGCTCGAGCATAATCCTTCCCTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)