EMAIL THIS PAGE TO A FRIEND

PDCL

phosducin-like

176 Gene Product Result for
Synonyms: PhLP
UniProtKB ID: Q13371, Q4VXB6, Q96AF1, Q9UEW7, Q9UFL0
Gene ID:
Human(5082) Summary: Phosducin-like protein is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin, a phosphoprotein expressed in retina and pineal gland. Both phosducin-like protein and phosphoducin have been shown to regulate G-protein signaling by binding to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Mouse(67466) phosducin-like
Rat(64013) phosducin-like
Zebrafish(323645) phosducin-like
chicken(772371) phosducin-like
domestic cat(101100425) phosducin-like
dog(609801) phosducin-like
naked mole-rat(101697107) phosducin-like
cow(286773) phosducin-like
cow(784169) phosducin-like protein-like
sheep(101111173) phosducin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005388 Rosetta Predictions human pricing
NM_022247 Rosetta Predictions rat pricing
NM_026176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080797 predicted 445
2 SASI_Hs01_00080798 predicted 682
3 SASI_Hs01_00080799 predicted 1027
4 SASI_Hs01_00080800 predicted 724
5 SASI_Hs01_00080801 predicted 947
6 SASI_Hs01_00080803 predicted 1041
7 SASI_Hs02_00339510 predicted 410
8 SASI_Hs01_00080804 predicted 812
9 SASI_Hs01_00080805 predicted 711
10 SASI_Hs01_00080806 predicted 470
11 SASI_Hs01_00080802 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263024 predicted 504
2 SASI_Rn02_00263025 predicted 491
3 SASI_Rn02_00263026 predicted 478
4 SASI_Rn02_00263027 predicted 490
5 SASI_Rn01_00054388 predicted 660
6 SASI_Rn02_00263028 predicted 664
7 SASI_Rn01_00054381 predicted 882
8 SASI_Rn01_00054383 predicted 751
9 SASI_Rn02_00263029 predicted 841
10 SASI_Rn01_00054384 predicted 703
11 SASI_Rn01_00054382 predicted 1006
12 SASI_Rn01_00054385 predicted 995
13 SASI_Rn01_00054386 predicted 983
14 SASI_Rn01_00054387 predicted 1109
15 SASI_Rn01_00054389 predicted 1024
16 SASI_Rn01_00054390 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128518 predicted 780
2 SASI_Mm01_00128519 predicted 824
3 SASI_Mm01_00128520 predicted 911
4 SASI_Mm01_00128521 predicted 1145
5 SASI_Mm01_00128522 predicted 1183
6 SASI_Mm01_00128523 predicted 1044
7 SASI_Mm01_00128524 predicted 576
8 SASI_Mm01_00128525 predicted 1082
9 SASI_Mm01_00128526 predicted 796
10 SASI_Mm01_00128527 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026176
VALIDATED
PDCL MISSION shRNA Bacterial Glycerol Stock
phosducin-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-816s1c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026176.2-477s1c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-577s21c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-916s21c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-634s1c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-633s1c1
Sequence:CCGGAGCACACTTATCATGGTTCATCTCGAGATGAACCATGATAAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026176.3-2023s21c1
Sequence:CCGGGCCACCTAAATACTATATGTTCTCGAGAACATATAGTATTTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-734s21c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026176
VALIDATED
PDCL MISSION shRNA shRNA Plasmid DNA
phosducin-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-816s1c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026176.2-477s1c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-577s21c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-916s21c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-634s1c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-633s1c1
Sequence:CCGGAGCACACTTATCATGGTTCATCTCGAGATGAACCATGATAAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026176.3-2023s21c1
Sequence:CCGGGCCACCTAAATACTATATGTTCTCGAGAACATATAGTATTTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-734s21c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026176
VALIDATED
PDCL MISSION shRNA Lentiviral Transduction Particles
phosducin-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-816s1c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026176.2-477s1c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-577s21c1
Sequence:CCGGGACAAGAACTTGGATGATGAACTCGAGTTCATCATCCAAGTTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-916s21c1
Sequence:CCGGGCGGGTGAATTGATTGGCAATCTCGAGATTGCCAATCAATTCACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-634s1c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026176.2-633s1c1
Sequence:CCGGAGCACACTTATCATGGTTCATCTCGAGATGAACCATGATAAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026176.3-2023s21c1
Sequence:CCGGGCCACCTAAATACTATATGTTCTCGAGAACATATAGTATTTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026176.3-734s21c1
Sequence:CCGGGCACACTTATCATGGTTCATACTCGAGTATGAACCATGATAAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005388
VALIDATED
PDCL MISSION shRNA Bacterial Glycerol Stock
phosducin-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-753s1c1
Sequence:CCGGCGAAGCCATGAATGGTTGCATCTCGAGATGCAACCATTCATGGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-475s1c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-541s1c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-1051s1c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-707s1c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-403s21c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-469s21c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-635s21c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-979s21c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005388
VALIDATED
PDCL MISSION shRNA shRNA Plasmid DNA
phosducin-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-753s1c1
Sequence:CCGGCGAAGCCATGAATGGTTGCATCTCGAGATGCAACCATTCATGGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-475s1c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-541s1c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-1051s1c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-707s1c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-403s21c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-469s21c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-635s21c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-979s21c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005388
VALIDATED
PDCL MISSION shRNA Lentiviral Transduction Particles
phosducin-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-753s1c1
Sequence:CCGGCGAAGCCATGAATGGTTGCATCTCGAGATGCAACCATTCATGGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-475s1c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-541s1c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-1051s1c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005388.2-707s1c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-403s21c1
Sequence:CCGGGAGGAGCAACAGAAACAGAAACTCGAGTTTCTGTTTCTGTTGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-469s21c1
Sequence:CCGGGCCATAATGAATGAGGACCAACTCGAGTTGGTCCTCATTCATTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-635s21c1
Sequence:CCGGGCATTGTCATCATGGTTCATACTCGAGTATGAACCATGATGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005388.3-979s21c1
Sequence:CCGGGATAGCGACCTGGAAATAGATCTCGAGATCTATTTCCAGGTCGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)