EMAIL THIS PAGE TO A FRIEND

PDE10A

phosphodiesterase 10A

59 Gene Product Result for
Synonyms: HSPDE10A
UniProtKB ID: Q9Y233, Q6FHX1, Q9HCP9, Q9NTV4, Q9ULW9, Q9Y5T1
Gene ID:
Human(10846) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
Mouse(23984) phosphodiesterase 10A
Rat(63885) phosphodiesterase 10A
Zebrafish(394077) phosphodiesterase 10A
domestic cat(101098715) phosphodiesterase 10A
Horse(100050311) phosphodiesterase 10A
dog(484073) phosphodiesterase 10A
chicken(421574) phosphodiesterase 10A
naked mole-rat(101711466) phosphodiesterase 10A
Domestic Rabbit(100340245) phosphodiesterase 10A
domestic guinea pig(100527955) phosphodiesterase 10A
cow(506061) phosphodiesterase 10A
sheep(101114027) phosphodiesterase 10A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D9766 Dipyridamole ≥98% (HPLC) human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006661 Rosetta Predictions human pricing
NM_022236 Rosetta Predictions rat pricing
NM_011866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052098 predicted 2168
2 SASI_Hs02_00342045 predicted 2230
3 SASI_Hs01_00052100 predicted 428
4 SASI_Hs01_00052101 predicted 1488
5 SASI_Hs01_00052102 predicted 1124
6 SASI_Hs01_00052103 predicted 1520
7 SASI_Hs01_00052104 predicted 788
8 SASI_Hs01_00052105 predicted 727
9 SASI_Hs01_00052106 predicted 2181
10 SASI_Hs01_00052107 predicted 2157
11 SASI_Hs01_00052099 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105277 predicted 1938
2 SASI_Rn01_00105278 predicted 1500
3 SASI_Rn01_00105279 predicted 1692
4 SASI_Rn01_00105280 predicted 2299
5 SASI_Rn01_00105281 predicted 393
6 SASI_Rn02_00263010 predicted 866
7 SASI_Rn01_00105282 predicted 1708
8 SASI_Rn01_00105283 predicted 1384
9 SASI_Rn02_00263011 predicted 1360
10 SASI_Rn01_00105284 predicted 1377
11 SASI_Rn01_00105285 predicted 1055
12 SASI_Rn01_00105286 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321642 predicted 446
2 SASI_Mm01_00036891 predicted 1744
3 SASI_Mm01_00036892 predicted 2447
4 SASI_Mm01_00036893 predicted 1790
5 SASI_Mm01_00036894 predicted 1077
6 SASI_Mm01_00036896 predicted 1757
7 SASI_Mm01_00036897 predicted 868
8 SASI_Mm01_00036898 predicted 1115
9 SASI_Mm01_00036899 predicted 848
10 SASI_Mm01_00036900 predicted 2678
11 SASI_Mm01_00036895 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011866
VALIDATED
PDE10A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 10A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011866.1-2976s1c1
Sequence:CCGGCCCTTGTTGTGAAGTTTACATCTCGAGATGTAAACTTCACAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-2270s1c1
Sequence:CCGGGCGAATGATATATATGCAGAACTCGAGTTCTGCATATATATCATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-1772s1c1
Sequence:CCGGCCTTACCACAACTGGAAGCATCTCGAGATGCTTCCAGTTGTGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011866.1-562s1c1
Sequence:CCGGCGACGGATTTGCACTGTACTTCTCGAGAAGTACAGTGCAAATCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1988s21c1
Sequence:CCGGGAGCGCAAAGGCCTGCTAATTCTCGAGAATTAGCAGGCCTTTGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-997s1c1
Sequence:CCGGCGACGTATCAAAGACATACTTCTCGAGAAGTATGTCTTTGATACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1046s21c1
Sequence:CCGGGCTTGGGCTTCCGTAGCAATACTCGAGTATTGCTACGGAAGCCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1175s21c1
Sequence:CCGGCTTGAACACATCATGATATATCTCGAGATATATCATGATGTGTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1118s21c1
Sequence:CCGGTTCCTACTCGACGTATCAAAGCTCGAGCTTTGATACGTCGAGTAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011866.2-3125s21c1
Sequence:CCGGTGTGACCTTCTTATAGGTTAACTCGAGTTAACCTATAAGAAGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011866
VALIDATED
PDE10A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 10A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011866.1-2976s1c1
Sequence:CCGGCCCTTGTTGTGAAGTTTACATCTCGAGATGTAAACTTCACAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-2270s1c1
Sequence:CCGGGCGAATGATATATATGCAGAACTCGAGTTCTGCATATATATCATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-1772s1c1
Sequence:CCGGCCTTACCACAACTGGAAGCATCTCGAGATGCTTCCAGTTGTGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011866.1-562s1c1
Sequence:CCGGCGACGGATTTGCACTGTACTTCTCGAGAAGTACAGTGCAAATCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1988s21c1
Sequence:CCGGGAGCGCAAAGGCCTGCTAATTCTCGAGAATTAGCAGGCCTTTGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-997s1c1
Sequence:CCGGCGACGTATCAAAGACATACTTCTCGAGAAGTATGTCTTTGATACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1046s21c1
Sequence:CCGGGCTTGGGCTTCCGTAGCAATACTCGAGTATTGCTACGGAAGCCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1175s21c1
Sequence:CCGGCTTGAACACATCATGATATATCTCGAGATATATCATGATGTGTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1118s21c1
Sequence:CCGGTTCCTACTCGACGTATCAAAGCTCGAGCTTTGATACGTCGAGTAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011866.2-3125s21c1
Sequence:CCGGTGTGACCTTCTTATAGGTTAACTCGAGTTAACCTATAAGAAGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011866
VALIDATED
PDE10A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 10A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011866.1-2976s1c1
Sequence:CCGGCCCTTGTTGTGAAGTTTACATCTCGAGATGTAAACTTCACAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-2270s1c1
Sequence:CCGGGCGAATGATATATATGCAGAACTCGAGTTCTGCATATATATCATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-1772s1c1
Sequence:CCGGCCTTACCACAACTGGAAGCATCTCGAGATGCTTCCAGTTGTGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011866.1-562s1c1
Sequence:CCGGCGACGGATTTGCACTGTACTTCTCGAGAAGTACAGTGCAAATCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1988s21c1
Sequence:CCGGGAGCGCAAAGGCCTGCTAATTCTCGAGAATTAGCAGGCCTTTGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011866.1-997s1c1
Sequence:CCGGCGACGTATCAAAGACATACTTCTCGAGAAGTATGTCTTTGATACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1046s21c1
Sequence:CCGGGCTTGGGCTTCCGTAGCAATACTCGAGTATTGCTACGGAAGCCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1175s21c1
Sequence:CCGGCTTGAACACATCATGATATATCTCGAGATATATCATGATGTGTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011866.2-1118s21c1
Sequence:CCGGTTCCTACTCGACGTATCAAAGCTCGAGCTTTGATACGTCGAGTAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011866.2-3125s21c1
Sequence:CCGGTGTGACCTTCTTATAGGTTAACTCGAGTTAACCTATAAGAAGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006661
PDE10A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 10A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1645s1c1
Sequence:CCGGCCACTTTGACATTGGTCCTTTCTCGAGAAAGGACCAATGTCAAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006661.1-4018s1c1
Sequence:CCGGGCCCATCATATCAAATAACTTCTCGAGAAGTTATTTGATATGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-2020s21c1
Sequence:CCGGCCAGTTGGAAGGGCACAATATCTCGAGATATTGTGCCCTTCCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-576s1c1
Sequence:CCGGCCGATGGATTTGCACTGTATTCTCGAGAATACAGTGCAAATCCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1129s1c1
Sequence:CCGGCCATAAGAACAAGGAGTTATACTCGAGTATAACTCCTTGTTCTTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-2173s1c1
Sequence:CCGGCGGATCACTAAACCTTAATAACTCGAGTTATTAAGGTTTAGTGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-1472s21c1
Sequence:CCGGGCCTTACACTGTGCTAATATGCTCGAGCATATTAGCACAGTGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-468s21c1
Sequence:CCGGATGAACTAAACAGCTATATAGCTCGAGCTATATAGCTGTTTAGTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006661
PDE10A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 10A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1645s1c1
Sequence:CCGGCCACTTTGACATTGGTCCTTTCTCGAGAAAGGACCAATGTCAAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006661.1-4018s1c1
Sequence:CCGGGCCCATCATATCAAATAACTTCTCGAGAAGTTATTTGATATGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-2020s21c1
Sequence:CCGGCCAGTTGGAAGGGCACAATATCTCGAGATATTGTGCCCTTCCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-576s1c1
Sequence:CCGGCCGATGGATTTGCACTGTATTCTCGAGAATACAGTGCAAATCCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1129s1c1
Sequence:CCGGCCATAAGAACAAGGAGTTATACTCGAGTATAACTCCTTGTTCTTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-2173s1c1
Sequence:CCGGCGGATCACTAAACCTTAATAACTCGAGTTATTAAGGTTTAGTGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-1472s21c1
Sequence:CCGGGCCTTACACTGTGCTAATATGCTCGAGCATATTAGCACAGTGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-468s21c1
Sequence:CCGGATGAACTAAACAGCTATATAGCTCGAGCTATATAGCTGTTTAGTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006661
PDE10A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 10A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1645s1c1
Sequence:CCGGCCACTTTGACATTGGTCCTTTCTCGAGAAAGGACCAATGTCAAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006661.1-4018s1c1
Sequence:CCGGGCCCATCATATCAAATAACTTCTCGAGAAGTTATTTGATATGATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-2020s21c1
Sequence:CCGGCCAGTTGGAAGGGCACAATATCTCGAGATATTGTGCCCTTCCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-576s1c1
Sequence:CCGGCCGATGGATTTGCACTGTATTCTCGAGAATACAGTGCAAATCCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-1129s1c1
Sequence:CCGGCCATAAGAACAAGGAGTTATACTCGAGTATAACTCCTTGTTCTTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006661.1-2173s1c1
Sequence:CCGGCGGATCACTAAACCTTAATAACTCGAGTTATTAAGGTTTAGTGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-1472s21c1
Sequence:CCGGGCCTTACACTGTGCTAATATGCTCGAGCATATTAGCACAGTGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006661.2-468s21c1
Sequence:CCGGATGAACTAAACAGCTATATAGCTCGAGCTATATAGCTGTTTAGTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)