EMAIL THIS PAGE TO A FRIEND

PDE11A

phosphodiesterase 11A

288 Gene Product Result for
Synonyms: PPNAD2
Gene ID:
Human(50940) Summary: The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(241489) phosphodiesterase 11A
Rat(140928) phosphodiesterase 11A
Zebrafish(561338) phosphodiesterase 11a
Horse(100053692) phosphodiesterase 11A
domestic cat(101100071) phosphodiesterase 11A
dog(488422) phosphodiesterase 11A
chicken(424133) phosphodiesterase 11A
cow(524446) phosphodiesterase 11A
sheep(101103537) phosphodiesterase 11A
domestic guinea pig(100302674) phosphodiesterase 11A
Domestic Rabbit(100341520) phosphodiesterase 11A
naked mole-rat(101700959) phosphodiesterase 11A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077196 Rosetta Predictions human pricing
NM_001077197 Rosetta Predictions human pricing
NM_001077358 Rosetta Predictions human pricing
NM_016953 Rosetta Predictions human pricing
NM_001127480 Rosetta Predictions rat pricing
NM_001127481 Rosetta Predictions rat pricing
NM_080893 Rosetta Predictions rat pricing
NM_001081033 Rosetta Predictions mouse pricing
XM_001003959 Rosetta Predictions mouse pricing
XM_001003960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312164 predicted 1219
2 SASI_Hs02_00312165 predicted 627
3 SASI_Hs02_00312166 predicted 1365
4 SASI_Hs02_00312167 predicted 822
5 SASI_Hs02_00312168 predicted 340
6 SASI_Hs02_00312169 predicted 338
7 SASI_Hs02_00312170 predicted 1149
8 SASI_Hs02_00312171 predicted 1196
9 SASI_Hs02_00312172 predicted 347
10 SASI_Hs02_00312173 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312174 predicted 1758
2 SASI_Hs02_00312175 predicted 1156
3 SASI_Hs02_00312176 predicted 1890
4 SASI_Hs02_00312177 predicted 1350
5 SASI_Hs02_00312178 predicted 865
6 SASI_Hs02_00312179 predicted 861
7 SASI_Hs02_00312180 predicted 1688
8 SASI_Hs02_00312181 predicted 1723
9 SASI_Hs02_00312182 predicted 877
10 SASI_Hs02_00312183 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312404 predicted 1468
2 SASI_Hs02_00312405 predicted 863
3 SASI_Hs02_00312406 predicted 1601
4 SASI_Hs02_00312407 predicted 1057
5 SASI_Hs02_00312408 predicted 580
6 SASI_Hs02_00312409 predicted 578
7 SASI_Hs02_00312410 predicted 1396
8 SASI_Hs02_00312411 predicted 1438
9 SASI_Hs02_00312412 predicted 592
10 SASI_Hs02_00312413 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104012 predicted 2727
2 SASI_Hs01_00104013 predicted 2124
3 SASI_Hs02_00349958 predicted 2857
4 SASI_Hs01_00104014 predicted 2319
5 SASI_Hs02_00349959 predicted 1835
6 SASI_Hs02_00349960 predicted 1837
7 SASI_Hs01_00104017 predicted 2651
8 SASI_Hs02_00349961 predicted 2700
9 SASI_Hs02_00349962 predicted 1845
10 SASI_Hs02_00349963 predicted 1906
11 SASI_Hs01_00104011 predicted 2939
12 SASI_Hs01_00104015 predicted 828
13 SASI_Hs01_00104016 predicted 2998
14 SASI_Hs01_00104018 predicted 2920
15 SASI_Hs01_00104019 predicted 2108
16 SASI_Hs01_00104020 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253813 predicted 1184
2 SASI_Rn02_00253814 predicted 1902
3 SASI_Rn02_00253815 predicted 2352
4 SASI_Rn02_00253816 predicted 1872
5 SASI_Rn02_00253817 predicted 1487
6 SASI_Rn02_00253818 predicted 789
7 SASI_Rn02_00253819 predicted 1981
8 SASI_Rn02_00253820 predicted 990
9 SASI_Rn02_00253821 predicted 902
10 SASI_Rn02_00253822 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253823 predicted 788
2 SASI_Rn02_00253824 predicted 1508
3 SASI_Rn02_00253825 predicted 1952
4 SASI_Rn02_00253826 predicted 1475
5 SASI_Rn02_00253827 predicted 1094
6 SASI_Rn02_00253828 predicted 395
7 SASI_Rn02_00253829 predicted 1580
8 SASI_Rn02_00253830 predicted 599
9 SASI_Rn02_00253831 predicted 506
10 SASI_Rn02_00253832 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267344 predicted 1858
2 SASI_Rn02_00267345 predicted 2580
3 SASI_Rn01_00084847 predicted 3028
4 SASI_Rn01_00084848 predicted 2552
5 SASI_Rn02_00267346 predicted 2167
6 SASI_Rn01_00084850 predicted 1471
7 SASI_Rn01_00084851 predicted 2650
8 SASI_Rn01_00084852 predicted 1668
9 SASI_Rn01_00084853 predicted 1583
10 SASI_Rn01_00084854 predicted 2602
11 SASI_Rn01_00084845 predicted 926
12 SASI_Rn01_00084846 predicted 834
13 SASI_Rn01_00084849 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294525 predicted 704
2 SASI_Mm02_00294526 predicted 2045
3 SASI_Mm02_00294527 predicted 2099
4 SASI_Mm02_00294528 predicted 1721
5 SASI_Mm02_00294529 predicted 1434
6 SASI_Mm02_00294530 predicted 1347
7 SASI_Mm02_00294531 predicted 1394
8 SASI_Mm02_00294532 predicted 2534
9 SASI_Mm02_00294533 predicted 1137
10 SASI_Mm02_00294534 predicted 2548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227269 predicted 314
2 SASI_Mm01_00227270 predicted 325
3 SASI_Mm01_00227271 predicted 270
4 SASI_Mm01_00227272 predicted 322
5 SASI_Mm01_00227273 predicted 234
6 SASI_Mm01_00227274 predicted 328
7 SASI_Mm01_00227275 predicted 288
8 SASI_Mm01_00227276 predicted 303
9 SASI_Mm01_00227277 predicted 319
10 SASI_Mm01_00227278 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243188 predicted 710
2 SASI_Mm01_00243189 predicted 2451
3 SASI_Mm01_00243190 predicted 804
4 SASI_Mm01_00243191 predicted 549
5 SASI_Mm01_00243192 predicted 2236
6 SASI_Mm01_00243193 predicted 757
7 SASI_Mm01_00243194 predicted 2424
8 SASI_Mm01_00243195 predicted 2367
9 SASI_Mm01_00243196 predicted 2548
10 SASI_Mm01_00243197 predicted 2411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016953
PDE11A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 11A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2728s21c1
Sequence:CCGGCGTGATATATTTCGATCAATGCTCGAGCATTGATCGAAATATATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1712s21c1
Sequence:CCGGCATACTCCGACTGGCTAATAACTCGAGTTATTAGCCAGTCGGAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2047s21c1
Sequence:CCGGGCTCTTGATGTGCTATCATACCTCGAGGTATGATAGCACATCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1612s21c1
Sequence:CCGGGAATCACCAGTGGTGAAATTTCTCGAGAAATTTCACCACTGGTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2651s1c1
Sequence:CCGGCGCTGTACTTTGAGAGGAGAACTCGAGTTCTCCTCTCAAAGTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-921s1c1
Sequence:CCGGGCGTCAGTTCTTTCTGGAATTCTCGAGAATTCCAGAAAGAACTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1339s1c1
Sequence:CCGGGCGATAAATAAGATTCCTGAACTCGAGTTCAGGAATCTTATTTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1194s1c1
Sequence:CCGGGCATGGAGAAACGGTCAACATCTCGAGATGTTGACCGTTTCTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2848s1c2
Sequence:CCGGCGGGAGAGATTAGAGCTCAAACTCGAGTTTGAGCTCTAATCTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016953
PDE11A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 11A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2728s21c1
Sequence:CCGGCGTGATATATTTCGATCAATGCTCGAGCATTGATCGAAATATATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1712s21c1
Sequence:CCGGCATACTCCGACTGGCTAATAACTCGAGTTATTAGCCAGTCGGAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2047s21c1
Sequence:CCGGGCTCTTGATGTGCTATCATACCTCGAGGTATGATAGCACATCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1612s21c1
Sequence:CCGGGAATCACCAGTGGTGAAATTTCTCGAGAAATTTCACCACTGGTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2651s1c1
Sequence:CCGGCGCTGTACTTTGAGAGGAGAACTCGAGTTCTCCTCTCAAAGTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-921s1c1
Sequence:CCGGGCGTCAGTTCTTTCTGGAATTCTCGAGAATTCCAGAAAGAACTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1339s1c1
Sequence:CCGGGCGATAAATAAGATTCCTGAACTCGAGTTCAGGAATCTTATTTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1194s1c1
Sequence:CCGGGCATGGAGAAACGGTCAACATCTCGAGATGTTGACCGTTTCTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2848s1c2
Sequence:CCGGCGGGAGAGATTAGAGCTCAAACTCGAGTTTGAGCTCTAATCTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016953
PDE11A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 11A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2728s21c1
Sequence:CCGGCGTGATATATTTCGATCAATGCTCGAGCATTGATCGAAATATATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1712s21c1
Sequence:CCGGCATACTCCGACTGGCTAATAACTCGAGTTATTAGCCAGTCGGAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-2047s21c1
Sequence:CCGGGCTCTTGATGTGCTATCATACCTCGAGGTATGATAGCACATCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016953.3-1612s21c1
Sequence:CCGGGAATCACCAGTGGTGAAATTTCTCGAGAAATTTCACCACTGGTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2651s1c1
Sequence:CCGGCGCTGTACTTTGAGAGGAGAACTCGAGTTCTCCTCTCAAAGTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-921s1c1
Sequence:CCGGGCGTCAGTTCTTTCTGGAATTCTCGAGAATTCCAGAAAGAACTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1339s1c1
Sequence:CCGGGCGATAAATAAGATTCCTGAACTCGAGTTCAGGAATCTTATTTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-1194s1c1
Sequence:CCGGGCATGGAGAAACGGTCAACATCTCGAGATGTTGACCGTTTCTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016953.2-2848s1c2
Sequence:CCGGCGGGAGAGATTAGAGCTCAAACTCGAGTTTGAGCTCTAATCTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081033
PDE11A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 11A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1305s21c1
Sequence:CCGGGTGAACGCTGTTCCGTCTTACCTCGAGGTAAGACGGAACAGCGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1142s21c1
Sequence:CCGGTGTGGAATCGCCATATCTAATCTCGAGATTAGATATGGCGATTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-2343s21c1
Sequence:CCGGAGCTCCTGAAGCAGTCAATATCTCGAGATATTGACTGCTTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-606s21c1
Sequence:CCGGCTACGGCCATCGACTACAAATCTCGAGATTTGTAGTCGATGGCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1056s21c1
Sequence:CCGGGTGTGGCCCAGGCGATAAATACTCGAGTATTTATCGCCTGGGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081033
PDE11A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 11A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1305s21c1
Sequence:CCGGGTGAACGCTGTTCCGTCTTACCTCGAGGTAAGACGGAACAGCGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1142s21c1
Sequence:CCGGTGTGGAATCGCCATATCTAATCTCGAGATTAGATATGGCGATTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-2343s21c1
Sequence:CCGGAGCTCCTGAAGCAGTCAATATCTCGAGATATTGACTGCTTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-606s21c1
Sequence:CCGGCTACGGCCATCGACTACAAATCTCGAGATTTGTAGTCGATGGCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1056s21c1
Sequence:CCGGGTGTGGCCCAGGCGATAAATACTCGAGTATTTATCGCCTGGGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081033
PDE11A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 11A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1305s21c1
Sequence:CCGGGTGAACGCTGTTCCGTCTTACCTCGAGGTAAGACGGAACAGCGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1142s21c1
Sequence:CCGGTGTGGAATCGCCATATCTAATCTCGAGATTAGATATGGCGATTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-2343s21c1
Sequence:CCGGAGCTCCTGAAGCAGTCAATATCTCGAGATATTGACTGCTTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-606s21c1
Sequence:CCGGCTACGGCCATCGACTACAAATCTCGAGATTTGTAGTCGATGGCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081033.1-1056s21c1
Sequence:CCGGGTGTGGCCCAGGCGATAAATACTCGAGTATTTATCGCCTGGGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)