EMAIL THIS PAGE TO A FRIEND

PDE1A

phosphodiesterase 1A, calmodulin-dependent

121 Gene Product Result for
Synonyms: CAM-PDE-1A HCAM-1 HCAM1 HSPDE1A
Gene ID:
Human(5136) Summary: Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]
Mouse(18573) phosphodiesterase 1A, calmodulin-dependent
Rat(81529) phosphodiesterase 1A, calmodulin-dependent
Zebrafish(564465) phosphodiesterase 1A, calmodulin-dependent
chicken(424116) phosphodiesterase 1A, calmodulin-dependent
dog(403652) phosphodiesterase 1A, calmodulin-dependent
domestic cat(101083101) phosphodiesterase 1A, calmodulin-dependent
Horse(100054082) phosphodiesterase 1A, calmodulin-dependent
cow(281969) phosphodiesterase 1A, calmodulin-dependent
sheep(101119369) phosphodiesterase 1A, calmodulin-dependent
domestic guinea pig(100527956) phosphodiesterase 1A, calmodulin-dependent
naked mole-rat(101712147) phosphodiesterase 1A, calmodulin-dependent
Domestic Rabbit(100346878) phosphodiesterase 1A, calmodulin-dependent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M2547 8-Methoxymethyl-3-isobutyl-1-methylxanthine ≥98% human pricing
V6383 Vinpocetine ≥98%, solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003683 Rosetta Predictions human pricing
NM_005019 Rosetta Predictions human pricing
NM_030871 Rosetta Predictions rat pricing
NM_001009978 Rosetta Predictions mouse pricing
NM_001009979 Rosetta Predictions mouse pricing
NM_016744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205158 predicted 375
2 SASI_Hs01_00205159 predicted 496
3 SASI_Hs01_00205160 predicted 601
4 SASI_Hs01_00205162 predicted 544
5 SASI_Hs01_00205163 predicted 768
6 SASI_Hs01_00205164 predicted 273
7 SASI_Hs01_00205165 predicted 561
8 SASI_Hs01_00205166 predicted 1326
9 SASI_Hs01_00205167 predicted 439
10 SASI_Hs02_00304318 predicted 1335
11 SASI_Hs01_00205161 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032409 predicted 439
2 SASI_Hs01_00032410 predicted 560
3 SASI_Hs01_00032411 predicted 661
4 SASI_Hs01_00032413 predicted 612
5 SASI_Hs01_00032414 predicted 830
6 SASI_Hs01_00032415 predicted 337
7 SASI_Hs01_00032416 predicted 631
8 SASI_Hs01_00032417 predicted 1389
9 SASI_Hs01_00032418 predicted 499
10 SASI_Hs02_00338792 predicted 1399
11 SASI_Hs01_00032412 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081965 predicted 629
2 SASI_Rn01_00081966 predicted 1020
3 SASI_Rn01_00081967 predicted 801
4 SASI_Rn01_00081968 predicted 536
5 SASI_Rn01_00081969 predicted 1041
6 SASI_Rn01_00081970 predicted 1713
7 SASI_Rn01_00081973 predicted 866
8 SASI_Rn02_00264134 predicted 483
9 SASI_Rn01_00081974 predicted 868
10 SASI_Rn02_00264135 predicted 1456
11 SASI_Rn01_00081971 predicted 677
12 SASI_Rn01_00081972 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042874 predicted 786
2 SASI_Mm01_00042875 predicted 1018
3 SASI_Mm01_00042876 predicted 908
4 SASI_Mm01_00042877 predicted 302
5 SASI_Mm01_00042878 predicted 1085
6 SASI_Mm01_00042879 predicted 524
7 SASI_Mm01_00042880 predicted 356
8 SASI_Mm01_00042881 predicted 1084
9 SASI_Mm01_00042882 predicted 288
10 SASI_Mm01_00042883 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089236 predicted 782
2 SASI_Mm01_00089237 predicted 1019
3 SASI_Mm01_00089238 predicted 901
4 SASI_Mm01_00089239 predicted 296
5 SASI_Mm01_00089240 predicted 1079
6 SASI_Mm01_00089241 predicted 530
7 SASI_Mm01_00089242 predicted 347
8 SASI_Mm01_00089243 predicted 1083
9 SASI_Mm01_00089244 predicted 283
10 SASI_Mm01_00089245 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174951 predicted 1080
2 SASI_Mm01_00174952 predicted 1313
3 SASI_Mm01_00174953 predicted 1201
4 SASI_Mm01_00174954 predicted 596
5 SASI_Mm01_00174955 predicted 1379
6 SASI_Mm01_00174956 predicted 824
7 SASI_Mm01_00174957 predicted 648
8 SASI_Mm01_00174958 predicted 1377
9 SASI_Mm01_00174959 predicted 582
10 SASI_Mm01_00174960 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003683
PDE1A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1A, calmodulin-dependent
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-558s21c1
Sequence:CCGGTAAATGGTCTTTCGATGTATTCTCGAGAATACATCGAAAGACCATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-1492s21c1
Sequence:CCGGGATGCACTAAGACGATCAAATCTCGAGATTTGATCGTCTTAGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-173s1c1
Sequence:CCGGGCCTGAAAGGAATACTAAGATCTCGAGATCTTAGTATTCCTTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-1523s1c1
Sequence:CCGGCCATGAGTGATGGGTCCTATTCTCGAGAATAGGACCCATCACTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-976s1c1
Sequence:CCGGCGACTTATGCAAGAAGAAGAACTCGAGTTCTTCTTCTTGCATAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003683.1-1839s1c1
Sequence:CCGGCCACATAAATAACAGCTGTAACTCGAGTTACAGCTGTTATTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-231s1c1
Sequence:CCGGCGTCGACTTAAAGAAGAATATCTCGAGATATTCTTCTTTAAGTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003683
PDE1A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1A, calmodulin-dependent
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-558s21c1
Sequence:CCGGTAAATGGTCTTTCGATGTATTCTCGAGAATACATCGAAAGACCATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-1492s21c1
Sequence:CCGGGATGCACTAAGACGATCAAATCTCGAGATTTGATCGTCTTAGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-173s1c1
Sequence:CCGGGCCTGAAAGGAATACTAAGATCTCGAGATCTTAGTATTCCTTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-1523s1c1
Sequence:CCGGCCATGAGTGATGGGTCCTATTCTCGAGAATAGGACCCATCACTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-976s1c1
Sequence:CCGGCGACTTATGCAAGAAGAAGAACTCGAGTTCTTCTTCTTGCATAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003683.1-1839s1c1
Sequence:CCGGCCACATAAATAACAGCTGTAACTCGAGTTACAGCTGTTATTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-231s1c1
Sequence:CCGGCGTCGACTTAAAGAAGAATATCTCGAGATATTCTTCTTTAAGTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003683
PDE1A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1A, calmodulin-dependent
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-558s21c1
Sequence:CCGGTAAATGGTCTTTCGATGTATTCTCGAGAATACATCGAAAGACCATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003683.1-1492s21c1
Sequence:CCGGGATGCACTAAGACGATCAAATCTCGAGATTTGATCGTCTTAGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-173s1c1
Sequence:CCGGGCCTGAAAGGAATACTAAGATCTCGAGATCTTAGTATTCCTTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-1523s1c1
Sequence:CCGGCCATGAGTGATGGGTCCTATTCTCGAGAATAGGACCCATCACTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-976s1c1
Sequence:CCGGCGACTTATGCAAGAAGAAGAACTCGAGTTCTTCTTCTTGCATAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003683.1-1839s1c1
Sequence:CCGGCCACATAAATAACAGCTGTAACTCGAGTTACAGCTGTTATTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003683.1-231s1c1
Sequence:CCGGCGTCGACTTAAAGAAGAATATCTCGAGATATTCTTCTTTAAGTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009978
PDE1A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1A, calmodulin-dependent
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009978.1-1433s1c1
Sequence:CCGGCAGACATAACAGCTTCACATTCTCGAGAATGTGAAGCTGTTATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-132s1c1
Sequence:CCGGGCTTCAACTTTCACACGCAAACTCGAGTTTGCGTGTGAAAGTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-1026s1c1
Sequence:CCGGGCTGAATTAGGGCTTCCATTTCTCGAGAAATGGAAGCCCTAATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-246s1c1
Sequence:CCGGAGGAAGAACTATCACATGGTTCTCGAGAACCATGTGATAGTTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-415s1c1
Sequence:CCGGGCTTCAAGATTCCTGTTTCTTCTCGAGAAGAAACAGGAATCTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009978
PDE1A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1A, calmodulin-dependent
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009978.1-1433s1c1
Sequence:CCGGCAGACATAACAGCTTCACATTCTCGAGAATGTGAAGCTGTTATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-132s1c1
Sequence:CCGGGCTTCAACTTTCACACGCAAACTCGAGTTTGCGTGTGAAAGTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-1026s1c1
Sequence:CCGGGCTGAATTAGGGCTTCCATTTCTCGAGAAATGGAAGCCCTAATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-246s1c1
Sequence:CCGGAGGAAGAACTATCACATGGTTCTCGAGAACCATGTGATAGTTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-415s1c1
Sequence:CCGGGCTTCAAGATTCCTGTTTCTTCTCGAGAAGAAACAGGAATCTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009978
PDE1A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1A, calmodulin-dependent
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114996    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009978.1-1433s1c1
Sequence:CCGGCAGACATAACAGCTTCACATTCTCGAGAATGTGAAGCTGTTATGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-132s1c1
Sequence:CCGGGCTTCAACTTTCACACGCAAACTCGAGTTTGCGTGTGAAAGTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-1026s1c1
Sequence:CCGGGCTGAATTAGGGCTTCCATTTCTCGAGAAATGGAAGCCCTAATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-246s1c1
Sequence:CCGGAGGAAGAACTATCACATGGTTCTCGAGAACCATGTGATAGTTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009978.1-415s1c1
Sequence:CCGGGCTTCAAGATTCCTGTTTCTTCTCGAGAAGAAACAGGAATCTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)