EMAIL THIS PAGE TO A FRIEND

PDE1B

phosphodiesterase 1B, calmodulin-dependent

128 Gene Product Result for
Synonyms: PDE1B1 PDES1B
UniProtKB ID: Q01064, Q92825, Q96KP3
Gene ID:
Human(5153) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Mouse(18574) phosphodiesterase 1B, Ca2+-calmodulin dependent
Rat(29691) phosphodiesterase 1B, calmodulin-dependent
Domestic Rabbit(100341084) phosphodiesterase 1B, calmodulin-dependent
naked mole-rat(101718122) phosphodiesterase 1B, calmodulin-dependent
domestic guinea pig(100527959) phosphodiesterase 1B, Ca2+-calmodulin dependent
cow(281970) phosphodiesterase 1B, calmodulin-dependent
sheep(101118773) phosphodiesterase 1B, calmodulin-dependent
dog(100856025) phosphodiesterase 1B, calmodulin-dependent
Horse(100064711) phosphodiesterase 1B, calmodulin-dependent
domestic cat(101094608) phosphodiesterase 1B, calmodulin-dependent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000924 Rosetta Predictions human pricing
NM_022710 Rosetta Predictions rat pricing
NM_008800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014443 predicted 803
2 SASI_Hs01_00014444 predicted 624
3 SASI_Hs01_00014445 predicted 604
4 SASI_Hs01_00014447 predicted 1421
5 SASI_Hs01_00014448 predicted 554
6 SASI_Hs01_00014449 predicted 277
7 SASI_Hs01_00014451 predicted 1619
8 SASI_Hs02_00303507 predicted 929
9 SASI_Hs02_00303508 predicted 349
10 SASI_Hs01_00014452 predicted 870
11 SASI_Hs01_00014446 predicted 1115
12 SASI_Hs01_00014450 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107695 predicted 473
2 SASI_Rn01_00107696 predicted 1079
3 SASI_Rn01_00107698 predicted 812
4 SASI_Rn02_00263537 predicted 1411
5 SASI_Rn01_00107699 predicted 1328
6 SASI_Rn01_00107700 predicted 516
7 SASI_Rn01_00107701 predicted 650
8 SASI_Rn01_00107702 predicted 1002
9 SASI_Rn01_00107703 predicted 437
10 SASI_Rn01_00107704 predicted 664
11 SASI_Rn01_00107697 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127317 predicted 927
2 SASI_Mm01_00127318 predicted 498
3 SASI_Mm01_00127319 predicted 1427
4 SASI_Mm02_00314713 predicted 479
5 SASI_Mm02_00314714 predicted 1350
6 SASI_Mm01_00127321 predicted 832
7 SASI_Mm01_00127322 predicted 1311
8 SASI_Mm01_00127323 predicted 915
9 SASI_Mm01_00127324 predicted 693
10 SASI_Mm01_00127325 predicted 891
11 SASI_Mm01_00127320 predicted 207
12 SASI_Mm01_00127326 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008800
PDE1B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1B, calmodulin-dependent
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-833s1c1
Sequence:CCGGCCTGTCAGAGATTGAGGTCTTCTCGAGAAGACCTCAATCTCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1485s1c1
Sequence:CCGGCCTTCTTTAGATGTGGACGTACTCGAGTACGTCCACATCTAAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008800.1-2027s1c1
Sequence:CCGGGCCTCCAAGTTTCTAAGCAATCTCGAGATTGCTTAGAAACTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-321s1c1
Sequence:CCGGCAAATCCTAGACACTGAAGATCTCGAGATCTTCAGTGTCTAGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1682s1c1
Sequence:CCGGCCAGAATGGGAATCTGGATTACTCGAGTAATCCAGATTCCCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-1320s21c1
Sequence:CCGGTGTGATCGCACTTCCACATTGCTCGAGCAATGTGGAAGTGCGATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-728s21c1
Sequence:CCGGGACAGGCTATGGGAAATATAACTCGAGTTATATTTCCCATAGCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-503s21c1
Sequence:CCGGGATGTTCCGGAGAACGTATACCTCGAGGTATACGTTCTCCGGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008800
PDE1B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1B, calmodulin-dependent
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-833s1c1
Sequence:CCGGCCTGTCAGAGATTGAGGTCTTCTCGAGAAGACCTCAATCTCTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1485s1c1
Sequence:CCGGCCTTCTTTAGATGTGGACGTACTCGAGTACGTCCACATCTAAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008800.1-2027s1c1
Sequence:CCGGGCCTCCAAGTTTCTAAGCAATCTCGAGATTGCTTAGAAACTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-321s1c1
Sequence:CCGGCAAATCCTAGACACTGAAGATCTCGAGATCTTCAGTGTCTAGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1682s1c1
Sequence:CCGGCCAGAATGGGAATCTGGATTACTCGAGTAATCCAGATTCCCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-1320s21c1
Sequence:CCGGTGTGATCGCACTTCCACATTGCTCGAGCAATGTGGAAGTGCGATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-728s21c1
Sequence:CCGGGACAGGCTATGGGAAATATAACTCGAGTTATATTTCCCATAGCCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-503s21c1
Sequence:CCGGGATGTTCCGGAGAACGTATACCTCGAGGTATACGTTCTCCGGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008800
PDE1B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1B, calmodulin-dependent
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-833s1c1
Sequence:CCGGCCTGTCAGAGATTGAGGTCTTCTCGAGAAGACCTCAATCTCTGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1485s1c1
Sequence:CCGGCCTTCTTTAGATGTGGACGTACTCGAGTACGTCCACATCTAAAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008800.1-2027s1c1
Sequence:CCGGGCCTCCAAGTTTCTAAGCAATCTCGAGATTGCTTAGAAACTTGGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-321s1c1
Sequence:CCGGCAAATCCTAGACACTGAAGATCTCGAGATCTTCAGTGTCTAGGATTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008800.1-1682s1c1
Sequence:CCGGCCAGAATGGGAATCTGGATTACTCGAGTAATCCAGATTCCCATTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-1320s21c1
Sequence:CCGGTGTGATCGCACTTCCACATTGCTCGAGCAATGTGGAAGTGCGATCACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-728s21c1
Sequence:CCGGGACAGGCTATGGGAAATATAACTCGAGTTATATTTCCCATAGCCTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008800.1-503s21c1
Sequence:CCGGGATGTTCCGGAGAACGTATACCTCGAGGTATACGTTCTCCGGAACATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000924
PDE1B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1B, calmodulin-dependent
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1624s1c1
Sequence:CCGGCAAGCGCATTCAGGAGAATAACTCGAGTTATTCTCCTGAATGCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-941s1c1
Sequence:CCGGGCTGCAGCTATCCATGATTATCTCGAGATAATCATGGATAGCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1078s1c1
Sequence:CCGGGCAGGATGATGAGATGAACATCTCGAGATGTTCATCTCATCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-379s1c1
Sequence:CCGGCATAGATGAGACACGGCAAATCTCGAGATTTGCCGTGTCTCATCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-246s1c1
Sequence:CCGGCCAGCAAGAAGATGTGGATTACTCGAGTAATCCACATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-925s21c1
Sequence:CCGGCATGCCCTGAGGACCATTGTTCTCGAGAACAATGGTCCTCAGGGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-949s21c1
Sequence:CCGGGAGTTGCTGACTCGGCATAACCTCGAGGTTATGCCGAGTCAGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1067s21c1
Sequence:CCGGAGATCCACGCAGCCGATGTTACTCGAGTAACATCGGCTGCGTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1218s21c1
Sequence:CCGGCATCCAGACCAAGTCAGAATGCTCGAGCATTCTGACTTGGTCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000924
PDE1B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1B, calmodulin-dependent
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1624s1c1
Sequence:CCGGCAAGCGCATTCAGGAGAATAACTCGAGTTATTCTCCTGAATGCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-941s1c1
Sequence:CCGGGCTGCAGCTATCCATGATTATCTCGAGATAATCATGGATAGCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1078s1c1
Sequence:CCGGGCAGGATGATGAGATGAACATCTCGAGATGTTCATCTCATCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-379s1c1
Sequence:CCGGCATAGATGAGACACGGCAAATCTCGAGATTTGCCGTGTCTCATCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-246s1c1
Sequence:CCGGCCAGCAAGAAGATGTGGATTACTCGAGTAATCCACATCTTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-925s21c1
Sequence:CCGGCATGCCCTGAGGACCATTGTTCTCGAGAACAATGGTCCTCAGGGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-949s21c1
Sequence:CCGGGAGTTGCTGACTCGGCATAACCTCGAGGTTATGCCGAGTCAGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1067s21c1
Sequence:CCGGAGATCCACGCAGCCGATGTTACTCGAGTAACATCGGCTGCGTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1218s21c1
Sequence:CCGGCATCCAGACCAAGTCAGAATGCTCGAGCATTCTGACTTGGTCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000924
PDE1B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1B, calmodulin-dependent
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1624s1c1
Sequence:CCGGCAAGCGCATTCAGGAGAATAACTCGAGTTATTCTCCTGAATGCGCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-941s1c1
Sequence:CCGGGCTGCAGCTATCCATGATTATCTCGAGATAATCATGGATAGCTGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-1078s1c1
Sequence:CCGGGCAGGATGATGAGATGAACATCTCGAGATGTTCATCTCATCATCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-379s1c1
Sequence:CCGGCATAGATGAGACACGGCAAATCTCGAGATTTGCCGTGTCTCATCTATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000924.2-246s1c1
Sequence:CCGGCCAGCAAGAAGATGTGGATTACTCGAGTAATCCACATCTTCTTGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000438231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-925s21c1
Sequence:CCGGCATGCCCTGAGGACCATTGTTCTCGAGAACAATGGTCCTCAGGGCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-949s21c1
Sequence:CCGGGAGTTGCTGACTCGGCATAACCTCGAGGTTATGCCGAGTCAGCAACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1067s21c1
Sequence:CCGGAGATCCACGCAGCCGATGTTACTCGAGTAACATCGGCTGCGTGGATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000924.3-1218s21c1
Sequence:CCGGCATCCAGACCAAGTCAGAATGCTCGAGCATTCTGACTTGGTCTGGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???