EMAIL THIS PAGE TO A FRIEND

PDE1C

phosphodiesterase 1C, calmodulin-dependent 70kDa

143 Gene Product Result for
Synonyms: Hcam3
UniProtKB ID: Q14123, B3KPC6, E9PE92, Q14124, Q8NB10
Gene ID:
Human(5137) Summary: Cyclic nucleotide phosphodiesterases (PDEs) catalyze hydrolysis of the cyclic nucleotides cAMP and cGMP to the corresponding nucleoside 5-prime-monophosphates. Mammalian PDEs have been classified into several families based on their biochemical properties. Members of the PDE1 family, such as PDE1C, are calmodulin (see MIM 114180)-dependent PDEs (CaM-PDEs) that are stimulated by a calcium-calmodulin complex (Repaske et al., 1992 [PubMed 1326532]
Mouse(18575) phosphodiesterase 1C
Rat(81742) phosphodiesterase 1C
fruit fly(34594) CG44007 gene product from transcript CG44007-RG
Zebrafish(100536162) phosphodiesterase 1C, calmodulin-dependent 70kDa
Horse(100070015) phosphodiesterase 1C, calmodulin-dependent 70kDa
domestic cat(101089682) phosphodiesterase 1C, calmodulin-dependent 70kDa
dog(475272) phosphodiesterase 1C, calmodulin-dependent 70kDa
chicken(420752) phosphodiesterase 1C, calmodulin-dependent 70kDa
cow(526211) phosphodiesterase 1C, calmodulin-dependent 70kDa
sheep(101121508) phosphodiesterase 1C, calmodulin-dependent 70kDa
domestic guinea pig(100726194) phosphodiesterase 1C, calmodulin-dependent 70kDa
naked mole-rat(101717015) phosphodiesterase 1C, calmodulin-dependent 70kDa
Domestic Rabbit(100347155) phosphodiesterase 1C, calmodulin-dependent 70kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005020 Rosetta Predictions human pricing
NM_031078 Rosetta Predictions rat pricing
NM_001025568 Rosetta Predictions mouse pricing
NM_011054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067694 predicted 893
2 SASI_Hs01_00067695 predicted 1071
3 SASI_Hs01_00067696 predicted 595
4 SASI_Hs01_00067698 predicted 1273
5 SASI_Hs01_00067699 predicted 1505
6 SASI_Hs02_00338793 predicted 453
7 SASI_Hs01_00067700 predicted 631
8 SASI_Hs01_00067701 predicted 2169
9 SASI_Hs01_00067702 predicted 1007
10 SASI_Hs01_00067703 predicted 638
11 SASI_Hs01_00067697 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264318 predicted 1539
2 SASI_Rn01_00043505 predicted 2270
3 SASI_Rn01_00043506 predicted 935
4 SASI_Rn01_00043507 predicted 1342
5 SASI_Rn01_00043508 predicted 1238
6 SASI_Rn01_00043510 predicted 1644
7 SASI_Rn01_00043511 predicted 1339
8 SASI_Rn02_00264319 predicted 2608
9 SASI_Rn01_00043512 predicted 2569
10 SASI_Rn01_00043513 predicted 951
11 SASI_Rn01_00043504 predicted 1498
12 SASI_Rn01_00043509 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178095 predicted 1964
2 SASI_Mm01_00178096 predicted 1805
3 SASI_Mm01_00178097 predicted 1238
4 SASI_Mm01_00178098 predicted 1195
5 SASI_Mm01_00178099 predicted 1329
6 SASI_Mm01_00178100 predicted 1894
7 SASI_Mm01_00178101 predicted 1308
8 SASI_Mm01_00178102 predicted 1597
9 SASI_Mm01_00178103 predicted 1422
10 SASI_Mm01_00178104 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167276 predicted 2004
2 SASI_Mm01_00167277 predicted 1851
3 SASI_Mm01_00167278 predicted 1286
4 SASI_Mm01_00167279 predicted 1234
5 SASI_Mm01_00167280 predicted 1379
6 SASI_Mm01_00167281 predicted 1934
7 SASI_Mm01_00167282 predicted 1355
8 SASI_Mm01_00167283 predicted 1642
9 SASI_Mm01_00167284 predicted 1470
10 SASI_Mm01_00167285 predicted 1061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005020
VALIDATED
PDE1C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1C, calmodulin-dependent 70kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-934s21c1
Sequence:CCGGTGACGGAGCTGGAGATCTTTGCTCGAGCAAAGATCTCCAGCTCCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-342s21c1
Sequence:CCGGGCTTCAGTGGTAGATCTTAAGCTCGAGCTTAAGATCTACCACTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-718s21c1
Sequence:CCGGGGGATCATGCACTGAAATTTACTCGAGTAAATTTCAGTGCATGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1023s21c1
Sequence:CCGGACTCGGTCTGATCCAGCTATTCTCGAGAATAGCTGGATCAGACCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1517s21c1
Sequence:CCGGGAAGATTGTGAGTCCATTAATCTCGAGATTAATGGACTCACAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005020.1-2502s21c1
Sequence:CCGGTGTCAATGCCGTTACTTTAAACTCGAGTTTAAAGTAACGGCATTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1163s21c1
Sequence:CCGGTCGAACCTTGGTAATTGAAATCTCGAGATTTCAATTACCAAGGTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-1652s1c1
Sequence:CCGGCCCGATCAACAATTCTGTCATCTCGAGATGACAGAATTGTTGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-645s1c1
Sequence:CCGGCCAGCTGTTATTGAGGCATTACTCGAGTAATGCCTCAATAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1675s1c1
Sequence:CCGGCCGTTGACTATAAGAGCTTTACTCGAGTAAAGCTCTTATAGTCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1574s1c1
Sequence:CCGGGCGTTCGAGTTTGAATAGCATCTCGAGATGCTATTCAAACTCGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-309s1c1
Sequence:CCGGCGGTCTTTGGTCAAACAATTACTCGAGTAATTGTTTGACCAAAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005020
VALIDATED
PDE1C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1C, calmodulin-dependent 70kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-934s21c1
Sequence:CCGGTGACGGAGCTGGAGATCTTTGCTCGAGCAAAGATCTCCAGCTCCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-342s21c1
Sequence:CCGGGCTTCAGTGGTAGATCTTAAGCTCGAGCTTAAGATCTACCACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-718s21c1
Sequence:CCGGGGGATCATGCACTGAAATTTACTCGAGTAAATTTCAGTGCATGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1023s21c1
Sequence:CCGGACTCGGTCTGATCCAGCTATTCTCGAGAATAGCTGGATCAGACCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1517s21c1
Sequence:CCGGGAAGATTGTGAGTCCATTAATCTCGAGATTAATGGACTCACAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005020.1-2502s21c1
Sequence:CCGGTGTCAATGCCGTTACTTTAAACTCGAGTTTAAAGTAACGGCATTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1163s21c1
Sequence:CCGGTCGAACCTTGGTAATTGAAATCTCGAGATTTCAATTACCAAGGTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-1652s1c1
Sequence:CCGGCCCGATCAACAATTCTGTCATCTCGAGATGACAGAATTGTTGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-645s1c1
Sequence:CCGGCCAGCTGTTATTGAGGCATTACTCGAGTAATGCCTCAATAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1675s1c1
Sequence:CCGGCCGTTGACTATAAGAGCTTTACTCGAGTAAAGCTCTTATAGTCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1574s1c1
Sequence:CCGGGCGTTCGAGTTTGAATAGCATCTCGAGATGCTATTCAAACTCGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-309s1c1
Sequence:CCGGCGGTCTTTGGTCAAACAATTACTCGAGTAATTGTTTGACCAAAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005020
VALIDATED
PDE1C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1C, calmodulin-dependent 70kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-934s21c1
Sequence:CCGGTGACGGAGCTGGAGATCTTTGCTCGAGCAAAGATCTCCAGCTCCGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-342s21c1
Sequence:CCGGGCTTCAGTGGTAGATCTTAAGCTCGAGCTTAAGATCTACCACTGAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-718s21c1
Sequence:CCGGGGGATCATGCACTGAAATTTACTCGAGTAAATTTCAGTGCATGATCCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1023s21c1
Sequence:CCGGACTCGGTCTGATCCAGCTATTCTCGAGAATAGCTGGATCAGACCGAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1517s21c1
Sequence:CCGGGAAGATTGTGAGTCCATTAATCTCGAGATTAATGGACTCACAATCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005020.1-2502s21c1
Sequence:CCGGTGTCAATGCCGTTACTTTAAACTCGAGTTTAAAGTAACGGCATTGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005020.1-1163s21c1
Sequence:CCGGTCGAACCTTGGTAATTGAAATCTCGAGATTTCAATTACCAAGGTTCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-1652s1c1
Sequence:CCGGCCCGATCAACAATTCTGTCATCTCGAGATGACAGAATTGTTGATCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-645s1c1
Sequence:CCGGCCAGCTGTTATTGAGGCATTACTCGAGTAATGCCTCAATAACAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1675s1c1
Sequence:CCGGCCGTTGACTATAAGAGCTTTACTCGAGTAAAGCTCTTATAGTCAACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005020.1-1574s1c1
Sequence:CCGGGCGTTCGAGTTTGAATAGCATCTCGAGATGCTATTCAAACTCGAACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005020.1-309s1c1
Sequence:CCGGCGGTCTTTGGTCAAACAATTACTCGAGTAATTGTTTGACCAAAGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025568
PDE1C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 1C, calmodulin-dependent 70kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000114921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025568.1-4106s1c1
Sequence:CCGGGCCCAGTATCATGGGCTATATCTCGAGATATAGCCCATGATACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-2279s1c1
Sequence:CCGGCGGTGACTTGAAAGACGGTAACTCGAGTTACCGTCTTTCAAGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-1953s1c1
Sequence:CCGGCCCATCAACAATTCTGTCATTCTCGAGAATGACAGAATTGTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-609s1c1
Sequence:CCGGCGGTCTTTGGTCAAGCAATTACTCGAGTAATTGCTTGACCAAAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025568
PDE1C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 1C, calmodulin-dependent 70kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000114921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025568.1-4106s1c1
Sequence:CCGGGCCCAGTATCATGGGCTATATCTCGAGATATAGCCCATGATACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-2279s1c1
Sequence:CCGGCGGTGACTTGAAAGACGGTAACTCGAGTTACCGTCTTTCAAGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-1953s1c1
Sequence:CCGGCCCATCAACAATTCTGTCATTCTCGAGAATGACAGAATTGTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-609s1c1
Sequence:CCGGCGGTCTTTGGTCAAGCAATTACTCGAGTAATTGCTTGACCAAAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025568
PDE1C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 1C, calmodulin-dependent 70kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000114921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025568.1-4106s1c1
Sequence:CCGGGCCCAGTATCATGGGCTATATCTCGAGATATAGCCCATGATACTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-2279s1c1
Sequence:CCGGCGGTGACTTGAAAGACGGTAACTCGAGTTACCGTCTTTCAAGTCACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-1953s1c1
Sequence:CCGGCCCATCAACAATTCTGTCATTCTCGAGAATGACAGAATTGTTGATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025568.1-609s1c1
Sequence:CCGGCGGTCTTTGGTCAAGCAATTACTCGAGTAATTGCTTGACCAAAGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???